-
The Mexican Kleptocracy: July 1989
April 19, 2013 | 0 comments
-
The Mexican Kleptocracy
April 19, 2013 | 3 comments
-
Black Plight: In Conflict With Unions
April 6, 2013 | 0 comments
-
An Assist from the Press
March 16, 2013 | 0 comments
-
Capitol Ideas
March 1, 2013 | 0 comments
Capitol Ideas
Extraterrestrial Intelligence and the Search for God
There’s got to be life out there, the atheistic view goes, none of it God-caused, of course.
A week doesn’t go by without the announcement of new planets. “Week Brings Hail of Planets” was just the most recent report. It capped a week of “new findings about worlds beyond our own solar system,” according to the Wall Street Journal. The latest marvel, 200 light years distant from Earth, has two suns. The reporter quoted John Knoll of Industrial Light & Magic as saying that this shows “science is stranger than fiction.” Actually, science fiction started this whole ball rolling, but that’s another story.
The search for extraterrestrial intelligence (SETI) has gone on for more than 50 years. In 1960 Frank Drake, a Cornell University astronomer, cobbled together the Drake Equation, supposedly quantifying the likelihood that intelligent life started up on its own. Nothing has yet been found and the search is getting harder to fund. Microsoft billionaire Paul Allen put up some money which was used to build the Allen Telescope Array in northern California, but now it is “in hibernation.” The University of California was supposed to operate the array, but they’re broke too. Government money has dried up. Three years ago I tried to visit the SETI Institute in Mountain View, California, and, on a Wednesday, found the place locked up at midday. A night watchman came to the door. “Closed,” he said.
What scientists are looking for, of course, is extra-terrestrial life, not rocks orbiting stars. The late novelist Michael Crichton gave an entertaining lecture at Caltech in 2003 saying that the search for extraterrestrial intelligence is a religion. And in a way it is. Carl Sagan, one of its leading promoters, “believed in superior beings in space, creatures so intelligent, so powerful, as to resemble gods.” He affirmed that a new civilization is formed just in our galaxy every 10 years. “There are a million technical civilizations in the [Milky Way] galaxy,” he believed.
That’s religion. The well-known atheist Richard Dawkins shows similar tendencies. He was quoted in the New York Times the other day as saying, “It’s highly plausible that in the universe there are Godlike creatures.” But he was careful to add that “these Gods came into being by an explicable scientific progression of incremental evolution.” (He would not have wanted to see “Gods” capitalized, however.)
Michael Crichton complained that the Drake Equation was vacuous because it had no data. Evolutionists plugged in their own numbers anyway, and in their math the probability of life arising by chance turned out to be a near certainty. All you needed was enough habitable platforms — planets — to work with. So that’s what we’re looking for. Other countries are looking, too.
The Nobel Prize-winning physicist Steven Weinberg argued in 2000 that if “calculations showed” that the odds of planets having gravity, temperature, and chemistry suitable for life were very small and “the earth on which we live were the only planet in the universe,” then a “benevolent designer” would “make sense.” Otherwise our “great good fortune in having come into being” would be puzzling. But now we know that lots of stars do have planets. So, Weinberg added, “we need not be surprised that chance events governed by impersonal natural laws have produced intelligent life on at least one of the planets.”
Weinberg did no math here but simply assumed that the probabilities support the case he wants to make — that life arose accidentally. No need for God then! (Sigh of relief from the materialists.) Even assuming the existence of a Goldilocks planet — with temperature, gravity, and atmosphere seemingly friendly to life — the likelihood that life would appear spontaneously is an unknown. (Some think it’s close to zero.) Even if such life does appear, the probability that it will end up building radio telescopes and looking for other civilizations is equally unknown. That’s why Crichton called the Drake Equation vacuous.
The dominant assumption today is that all science must be based on a naturalistic premise. Matter in motion is all that exists; God and supernatural phenomena are ruled out a priori. All life, then, must have been caused by the random collision of particles. People like Weinberg, Dawkins, and Steven Hawking deny that any other way of looking at the world can be called scientific. Hence their hostility to the movement called intelligent design. They’re looking for intelligence but it must not have been designed. “Materialists cannot allow a divine foot in the door,” the Harvard professor R. C. Lewontin said 15 years ago.
There was a famous disagreement between Stephen Jay Gould and Dawkins: was evolution “progressive”? You could make it come out either way, but Gould had a point when he said that chemical ingredients could go through a billion-year struggle to assemble themselves into a cell, only to be reduced to ash in an instant by a bolt of lightning. Maybe random events can create life, but they can certainly destroy it.
We do know that the spontaneous origin of life is improbable. All efforts to create it in laboratories have failed, as have all attempts to find it anywhere else. Maybe it exists only on Earth — an unwelcome thought for those who decided long ago (on no evidence) that there is nothing exceptional about the human race. My own belief is that, without evidence of extraterrestrial life, news editors will soon tire of reporting on rocks floating in space (“worlds,” as one reporter misleadingly called them).
BEFORE THE ENLIGHTENMENT the universal assumption was that the origin of life involved divine creation. Darwin’s theory of evolution changed nothing in this regard. But evolution by natural selection couldn’t get started without life so Darwin accepted in The Origin that the first life was “breathed” by “the Creator.” Not that he believed in God. He later expressed a very modern animus against a creator who could have been more humane— by designing a world without pain, for example. In a letter 10 years later, he suggested that life got started by fortuitous chemical combination in a “warm little pond.”
If the present search eventually turns up an abundance of extraterrestrial life, what would the theological implications be? On the one hand it could support the current dogma that unaided natural laws can generate life. On the other, it would be reasonable to assume that if God could start life here, he could also have done so elsewhere—maybe in lots of places. Even if the search for extraterrestrial intelligence is successful, then, it would be unlikely to resolve the modern debate about the existence of God. (Maybe those newfound extraterrestrials would also have something interesting to tell us.)
Among other things, the Enlightenment inculcated a widespread faith in progress but we have lost it now. Darwin had it. So did John Stuart Mill, T. H. Huxley, Herbert Spencer, and a hundred other 19th century sages. The theory of evolution was its principal product. Change was identified with progress. Human nature was improving and people were becoming better people. Then came the Holocaust and the Gulag.
Over the last 50 years, we have seen something that is directly opposed to the faith in progress — actual disparagement of the human race. Misanthropy became fashionable. The late Stephen Jay Gould loved to deride our “need to see ourselves as separate and superior.” We repeatedly deplore our supposed “hubris.” Few have noticed that our modern misanthropy is at odds with the evolutionist faith. And for that reason,that secular faith, which the intelligentsia is so eager for us to embrace, is going to be harder and harder to instill.
After a generation of this groundless selfdenigration, it is difficult to believe that we might actually be exceptional. Yet if SETI draws a blank, as I believe it will, we may have to confront the idea that we are the only intelligent life in the Cosmos. We could hardly be more unique than that. Maybe God put us here alone amidst all those planets, stars, and galaxies — a nightmarish thought for our modern atheists.
About the Author
Tom Bethell is a senior editor of The American Spectator and author of The Politically Incorrect Guide to Science, The Noblest Triumph: Property and Prosperity Through the Ages, and most recently Questioning Einstein: Is Relativity Necessary? (2009).
Letter to the Editor View all comments (341) | Leave a comment
More Articles by Tom Bethell
More Articles From Capitol Ideas
http://spectator.org/archives/2011/11/08/extraterrestrial-intelligence
Follow us:
ADVERTISEMENT
SPONSORED LINKS
FLASHBACK TO: 1995
-
Pope Culture
A man of faith in a godless age is hitting Americans where it hurts.
-
Why the GOP Does Not, Like, Totally Suck
Mr. and Mrs. American Spectator Reader, let P.J. O’Rourke talk sense to your kids.
-
Dames at Sea
-
In the Absence of Guns
In Britain, defending your property can get you life.
-
The Metaphysical Martini
-
Counting the Costs of Clintonism
The debacle of this president’s administration is both a cause and a symptom of the decline of American values. Unless Congress impeaches him, that decline will go on unchecked. An eminent jurist surveys the damage and assesses the chances for the recovery of our culture.
-
Chuck McHagel
It won’t take long for conservatives to scratch this presidential wannabe off their 2008 scorecard.
-
The Legacy of Old John and Mother Fresh-Roasted
-
It’s the Best Time of the Year
The American Christmas, like the songs that celebrate it, makes room for everybody under the rainbow. Is that why so many people seem to be hostile to it?
-
The Bush Crack-Up
Was the President done in by the economy, or by the politics of the economy?
Clip of the Day
ADVERTISEMENT
Ken (Old Texican)| 11.8.11 @ 6:35AM
Are Klingons God's children too?
LarryK| 11.8.11 @ 8:41AM
No, They are children of Kahless.
Mike 3/505| 11.8.11 @ 9:00AM
Are you sure Kahles(s) has two s's?
Barbie| 11.8.11 @ 9:04AM
Ken, I hope you've found it in your heart to forgive Margie. We all remember the public feud you carried out here in public on AmSpec's comment pages.
Alan Brooks| 11.8.11 @ 10:11AM
"Ken, I hope you've found it in your heart to forgive Margie. We all remember the public feud you carried out here in public on AmSpec's comment pages"
But Margie hates Catholics like Jack in Wisconsin hates Jews.
Doctor Right| 11.8.11 @ 1:31PM
Margie does not "hate" Catholics.
Stop spreading lies.
Alan Brooks| 11.8.11 @ 5:44PM
"Margie does not 'hate' Catholics. Stop spreading lies."
How do we know for sure Jack in Wi. hates Jews? we can't look into his inner soul. Might be that Jack in Wisconsin can be said to not exactly love Jews. Maybe Jack doesn't love the bones of their bodies.
Jack just might not want to piss on a Jew if the Jew was on fire, that's all.
Doctor Right| 11.8.11 @ 5:48PM
Jack disparages Israel and Jews CONSTANTLY.
Margie is not a fan of Catholicism; that's NOT the same as saying that someone HATES Catholics.
Don't play games, Alan. You're smarter than that.
Margie| 11.8.11 @ 7:11PM
They know that, Dr. Right. They ARE playing games.
And Alan isn't even a Catholic, or at least not a practicing one, so he's a total game player.
And as to me not being a fan of Catholicism, no Christian can be a fan of it.
Most importantly, God isn't a fan of it.
It's a cult, and and one that is filled with deceit.
God gives strong drink to them that are perishing, like Ken the liar, and others who breathe their disgusting deceit.
Lotsa luck.
Dan| 11.8.11 @ 8:11PM
BIGOT ALERT!!!!!BIGOT ALERT!!!!
Margie the Bigot returns to prove she is a bigot. Go back under your rock. Brooks is Right. Dr Right is wrong.
Racer99| 11.9.11 @ 5:12AM
Dan and others.... attacking people because they openly give opinion is counter productive and really doesn't fit well into proper debates. We should be offering perceptions, descriptions, ideas, explanations and personal perspective for others to consider. We should do it in love and receive the perspective of others in love.
A cult is simply a religious group of persons who are viewed by a different religious community as "strange" or "sinister". The word has been twisted by some (it usually starts with a Pastor, Reverend, Minister etc.) into a derogatory insult.
It's a viewpoint issue not an emotional issue like HATE. As believers that Christ Jesus is our Lord and Savior it matters not what one Christian sect believes about a different sect. It is Christ who makes the determination, not man. As Christians I prefer to ignore the doctrinal differences and organizational differences of large Christian Organizations (Churches). I prefer to consider all who worship Him, who pray to Jesus, and who seek to follow his laws to be Christians. (Yes, even the Mormons). The "Church" is the body of all believers and I say "One church, one destiny".
Dan| 11.9.11 @ 7:19AM
Racer, you must be new here. Go back and read her stuff. It is not an attack to describe bigotry whether it is against Jews, Catholilcs, gays, blacks, etc.
Margie| 11.9.11 @ 12:37PM
Actually, a cult is a group of people who follow a man, and not Christ.
Genuine Christians follow Christ, and according to HIS WORD, as written in the Bible.
Genuine Christians speak the truth to lies, and expose them. There is only one Gospel of God, not many.
"Any one who goes ahead and does not abide in the doctrine of Christ does not have God.." 2 Jn. 1:9.
Mormonism has not the doctrine of Christ, nor does Catholicism. They are cults.
Repent and believe the Gospel of God.
Beginning with Mk. 1:1.
Dan| 11.9.11 @ 1:02PM
Margie,
We have been through this ad nauseam. You don't believe in the divinity of Jesus, you don't believe Jesus is God, so you are in no position to lecture anyone on Christianity.
You have your own cult which is fine for you but spare us the lectures since you aren't a Christian.
StanO| 11.10.11 @ 1:58PM
A cult is a subset of a greater culture, that diverges in key ways. Truthfully, Mormonism is not a cult, it is a completely separate religion. It's doctrines are so far aflung of historical Christianity, and the group of followers so large, it is it's own religion.
Under the overly broad definition of "cult", then Christianity is a cult of Judaism.
Appleby| 11.9.11 @ 7:04AM
I will pray for Margies conversion; every Thursday when the Rosary bids us pray for the grace of conversion, I pray for Stephen Hawking and two of my relatives, and I will add Margie to my list.
As for aliens -- if God is omnipotent, likely He would have created multiple universes and unlikely we puny Earthlings will ever find any of them. Or they will find us.
Margie| 11.9.11 @ 12:29PM
Appleby:
I am already IN Christ. Your prayers for my so-called conversion to your false Religion of Catholicism can never happen.
I suggest you pray for your own conversion, and that to the actual true Gospel of God. For right now, you've been had by the deceit and false teachings, which, if you abide them to your dying day, places you amongst the zillions of those who chose to reject His Word.
Why do you insist on false Religion in place of trust in the Living Word of God?
You will have to answer to Him.
"Jesus answered him, "If a man loves Me, he will keep My Word, and My Father will love him, and We will come to him and make Our home with him." Jn. 14:23.
God sets the standard, not you or me. You've read what He says. Keep HIS WORD.
Not the Pope's word, which is contrary to the Word of God.
I hope you repent.
Dan| 11.9.11 @ 1:05PM
Margie, you one week of self imposed exile has not changed you at all, still don't believe in the divinity of Jesus, that Jesus is God.
Believe whatever you want, just go away and stop lecturing on Christianity when you aren't a Christian.
JoeAllen| 12.6.11 @ 10:19PM
Margie, I am a Catholic and I agree with you. I think about 90% of Catholics belong to a cult, but there are about 10% of us who are Bible-believing Christians.
Dan| 11.8.11 @ 9:27PM
You are the one playing games, Right, read her stuff, not being a "fan" is your opinion of her hate then you need to take a closer look. She disparages Catholics and Catholicism CONSTANTLY, and in worse language than Jack disparages Israel.
You're smarter, Right, don't play games.
Ken (Old Texican)| 11.8.11 @ 3:10PM
Barbie, no forgiveness on my part is required. I have defended Margie here for years. Margie has not hurt me.
I am merely saddened when Christians put on blinders to throw away fellow Christians. Jesus certainly doesn't throw away our brothers in His name.
I have simply tried to counsel with her. None of our perceptions are complete or perfect... Heh there are going to be a lot of Roman Catholics utterly shocked to meet we Baptists at Jesus' feet in heaven.
Nick| 11.8.11 @ 3:21PM
Not this Roman Catholic, Ken!
I'll be too happy to be in the presence of God to worry about who else is there.
Thank you, for your kind words.
God Bless!
Todd Powers| 11.9.11 @ 12:31AM
Well said...
Nick| 11.9.11 @ 5:07PM
Thank you, Mr. Powers.
I appreciate it, very much.
God Bless!
Margie| 11.8.11 @ 6:46PM
Ken is a liar and a reprobate Christian and he knows it.
He has lied about me here for months. He has said I "asked him to marry him."
Yet I asked him to post the e mail, and he has not done so.
Ken is going to Hell unless he repents. How do I know this?
The Bible tells me so.
I revere God's Holy Words.
And I also hate liars and reprobaes, as He does.
Lotsa luck, Ken.
"But as for the cowardly, the faithless, the polluted, as for murderers, fornicators, sorcerers, idolaters, and all liars, their lot shall be in the lake that burns with fire and sulphur, which is the second death." Rev. 21:8.
Nick| 11.8.11 @ 8:14PM
Margie,
Keep reading:
"But nothing unclean shall enter it, nor any one who practices abomination or falsehood, but only those who are written in the Lamb's book of life." - Revelation 21:27
This verse is proof that there is a Purgatory.
Notice that Saint John says that nothing unclean will enter Heaven, not no one unclean. He does say that any one who practices abomination or falsehood will not enter Heaven.
John the Apostle makes the distinction between people in a state of mortal sin at death, who therefore go to Hell, and the uncleanness still attached to the souls of those who are in a state of grace at the moment of their deaths.
This uncleanness must be purged, as by fire (cf. 1 Cor. 3:15.) The soul must be perfect to see God face to face. This perfection happens in Purgatory, for those who need it.
God Bless!
Margie| 11.8.11 @ 8:24PM
It proves no such thing, and you know it.
That is Catholic drivel.
Repent and believe the Gospel of God.
Beginning with Mk. 1:1.
Nick| 11.8.11 @ 11:21PM
Margie,
You shouldn't call the Word of God drivel.
God Bless!
Margie| 11.9.11 @ 12:17PM
More deceit from you, as usual, Nick.
I didn't call His Word drivel as you know full well. Your Catholic perversion of His Word is the drivel.
Repent from your deceit, lest you perish, and believe the Gospel of God.
Beginning with Mk. 1:1.
Nick| 11.9.11 @ 2:13PM
Margie,
Again, all you have are mere assertions, no facts to back-up your claims.
Your only argument is, "No, you are wrong."
That is not an argument. It's what my nieces and nephews say to each other.
God Bless!
Margie| 11.9.11 @ 5:30PM
The Bible speaks for itself, and your phony Religion has perverted it, or at least lives to try to.
There is no Scripture backing the false and abominable teaching of "Purgatory."
It isn't in His Word.
And by insisting that there is such a thing, you, my old pal, are calling God a liar.
I hope you repent, liar.
Nick| 11.9.11 @ 6:03PM
Margie,
I've listed plenty of Scripture "backing" for Purgatory. You choose to ignore it. And, you have no rebuttal. So, it is not I who is calling God a liar.
I hope learn to receive God's graces of faith, hope, and charity.
May God Bless you and your family.
Yours in Christ, Nick
Margie| 11.9.11 @ 9:50PM
Actually Nick, the only thing you did was add to the Scripture, and you know full well what God says about doing that.
There is no such word in the Bible as Purgatory, nor does such a thing exist, only in the minds of the deceived and deceivers of your false Religion.
Just as there is no such thing as Popery, nor any of the other hundreds of false and abominable teachings of your cult.
As I said, I hope you repent. You've read what God does with liars. And with those who add to His Words.
Nick| 11.9.11 @ 11:43PM
Margie,
"There is no such word in the Bible as Purgatory [...]."
Yes, this is true. Purgatorium is a Latin word, and, there are no Latin words in the Bible, to my knowledge. It is called Sheol in Hebrew.
"You've read what God does with liars."
You had better hope that God doesn't include continually spreading falsehoods about others' religion.
God Bless!
p.s. In my last reply, that should have been: I hope you learn to receive God's graces of faith, hope, and charity.
Margie| 11.10.11 @ 1:23PM
Nick,
God's Word speaks for itself.
It includes NONE of the false doctrines of Catholicism.
There is no such teaching, nor is there a place called Purgatory.
REPENT, and believe the Gospel of God.
You are a deceiver, and being deceived.
Nick| 11.10.11 @ 7:29PM
Margie,
"God's Word speaks for itself."
No, God's Church does.
"It includes NONE of the false doctrines of Catholicism."
In includes most of them. Sacred Tradition takes care of the rest.
God Bless!
Margie| 11.10.11 @ 10:25PM
No,
God's Own Words speak for themselves, and not the Pope(s).
And you, nor anyone else has the authority to change or add teachings to His Words.
You already know what God is going to do to those who do that.
Repent, and believe the TRUE Gospel of God.
Which does not include the false teaching of "Purgatory", nor does it exist in His Words, anywhere.
I presented to you the Scripture, which you continue to reject, at your own peril.
His Words also do not include "sacred Traditions.", of a- false- and ungodly -Religion.
You are being deceived.
The Bible says this:
"So, then, brothers, stand firm and
strongly hold the teachings you were
taught, whether by word or by our letter." 2 Thess. 2:15.
Big difference between the
sacred traditions of Catholicism, which are not biblical, and the actual TEACHINGS of Christ and His Apostles, who were appointed by God.
More warning here:
"You hypocrites! Well did Isaiah prophesy of you, when he said: 'This people honors Me with their lips, but their heart is far from Me; in vain do they worship Me, teaching as doctrines the precepts of men.'" Mt. 15:7-9.
You choose to vainly worship Him, by rejecting His Words, and choosing the false teachings of a cult.
And again Jesus warns us:
"You leave the Commandment of God, and hold fast the tradition of men." Mk. 7:8.
"If we receive the testimony of men, the testimony of God is greater; for this is the testimony of God that He has borne witness to his Son." 1 Jn. 5:9.
Nick| 11.10.11 @ 11:20PM
Margie,
"I presented to you the Scripture, which you continue to reject, at your own peril."
No, I presented you the Scriptures, and you continue to reject His Holy Word.
Are you really bringing up 2 Thess. 2:15 to me? I was the one who showed you that the word Saint Paul used was traditions, i.e.,paradoseis in Greek. Not teachings, or, didaskalia in Greek.
Have you forgotten this already?
You have much to learn grasshopper. Ha-ha!
God Bless!
p.s. The warnings from Christ and the Apostles about false teachings were about the Gnostics, and the Arians, and the Montanists, and any other heresy that denied Christ's Church or Her teachings.
Margie| 11.11.11 @ 12:21AM
It's no laughing matter.
The word is teachings in Greek, and the Apostles warned repeatedly, as I posted their own words, to not believe anything that wasn't TAUGHT by them, and you read the Words of the Holy Spirit that spoke this through them.
What you are preaching is a different Gospel, and not that of Jesus Christ.
And you have read what God says about that.
I hope you repent, Papist.
You said:
"The warnings from Christ and the Apostles about false teachings were about the Gnostics, and the Arians, and the Montanists, and any other heresy that denied Christ's Church or Her teachings."
Christ's Church? That is NOT the Catholic Religion. It is His Body, and not a Religion or a physical building, but it is those who have placed their belief and trust in Him and His Word.
"Her teachings"? Not the Catholic Church's false teachings, which are an abomination to God.
Such as the lie of "Purgatory" where everyone can "get purified."
And many hundreds more of perverted teachings.
You really need to repent, and believe the TRUE Gospel of God.
Beginning with Mk. 1:1.
Nick| 11.11.11 @ 1:41AM
Margie,
"The word is teachings in Greek [...]."
You are completely wrong about this. And, you have admitted your mistake, in a past thread, when we discussed this same verse of Scripture, before. Shall I go find that thread, and link to it?
The word that Saint Paul used is paradoseis (traditions,) not didaskalia (teachings,) as you wrongly claim. Look it up in Strong's, I did.
Christ's Church is His Body. And, She is also His Bride. She is also the Catholic Church.
The person preaching a false gospel is not me, I'm afraid.
God Bless!
Margie| 11.11.11 @ 11:53AM
Liar. I admitted no such thing. And even if the word WERE traditions, the warning of the Holy Spirit spoken through the Apostle was to ONLY go by THEIRS.
The verse says, TAUGHT BY US.
We are to reject and expose false teachings that are contrary to what THEY taught, such as the false teachings of the Catholic cult, such as what you proclaim as truth but are lies and are against the Word of God.
Why do you not get it? It is because the truth is not in you.
Nick| 11.14.11 @ 1:19AM
Margie,
"And even if the word WERE traditions, the warning of the Holy Spirit spoken through the Apostle was to ONLY go by THEIRS."
Well, the word was paradoseis, i.e., traditions, according to Strong's. Look it up here:
http://biblos.com/2_thessalonians/2-15.htm
And, here:
http://concordances.org/greek/3862.htm
And, yes, we should only go by the teachings and traditions (which are synonymous) of the Apostles, which were ultimately Christ's teachings. These teachings and traditions are found, completely, in the Catholic Church.
Why don't you get it?
God Bless!
Rich D| 11.12.11 @ 10:51AM
Nick - your Greek stinks. The verse is "pay attention to the instructions (teachings) that you were caused to learn." You really need to give up on this pretense at being a New Testament scholar.
It has nothing to do with the Roman sect's nonsense of a magisterium. When the word was used it almost always referred to learning Scripture, the written Word of God. There are 220 instances of cognates of imparting knowledge in the NT.
Nick| 11.14.11 @ 1:35AM
Rich D.,
"Nick - your Greek stinks."
It's not my Greek, it's Strong's. See my reply to Margie, above.
"You really need to give up on this pretense at being a New Testament scholar."
I've never made such a pretense. You, on the other hand, well...
"When the word was used it almost always referred to learning Scripture, the written Word of God."
Saint Paul specifically says, "whether by word [orally] or by epistle [written]." Saint Paul also used Jewish traditions not found in the Old Testament Scriptures, as did Jude (cf 2 Tim. 3:8; 1 Cor. 10:4; Heb. 11:37; Jude 9, 14-15).
I can give many other examples, if you'd like.
God Bless!
Rich D| 11.14.11 @ 11:41AM
Strong's is just an old lexicon and provides no guidance as to how words were used in the local and classic culture of the time. Tell me you can learn a language from a dictionary. Buy a copy of BDB and then take...no, never mind - you're hopelessly hung up on a gospel of men and works. Without grounding in Biblical languages and church history, you are at the mercy of false teachings. Turn your obviously good intelligence to something that you can be successful at.
Your examples do not counter the plain meaning of the verse that is in contention. You have violated principles of hermeneutics. Sorry.
Nick| 11.14.11 @ 8:24PM
Rich D.,
None of what you have written changes the fact that Saint Paul used the word paradoseis in 2 Thess. 2:15, not didaskalia. Nor, does your reply change the fact that Paul included oral, as well as written, teachings in his admonition to the Thessolonians.
If you had read my reply to Margie, you would have seen that I consider traditions and teachings to be synonymous. It is Margie who claims that there is a huge difference between which word is used, in this example. However v. 15 is translated, it still means the same thing. The traditions that Paul taught to the Thessalonians, or Timothy, were taught to "other faithful men," who then went on to teach others the Gospel of Christ (cf 2 Tim. 2:2). Just as He intended.
You, sir, are not interested in an honest conversation about these subjects. You are only interested in making sarcastic comments. Let me know if you would like to make any substantive arguments, okay?
God Bless!
Rich D| 11.16.11 @ 10:12AM
So, you say my arguments aren't substantive and then accuse me of sarcasm?! Funny man!
Tell me what I said that you think is dishonest.
Dannyboy| 11.9.11 @ 7:50PM
Nick, you are wasting your time trying to have a reasonable conversation with a bigot who doesn't believe in the divinity of Jesus, that Jesus is God. You have a lot of patience and good will.
Nick| 11.9.11 @ 11:47PM
Dannyboy,
I pray for patience. I don't always show enough of it, though. I was friends with Margie for a couple of years, until quite recently. So, I know who I am dealing with.
Thanks for the advice, but it is never a waste of time to share the Good News of Jesus Christ with anyone. The Holy Spirit will handle the tough part.
God Bless!
Margie| 11.10.11 @ 3:46PM
"I know who I am dealing with."
You don't DEAL with me, kiddo. But God's gonna DEAL with you.
As to Sheol, my God says this, read it and weep, Papist:
"Sheol beneath is stirred up to meet you when you come, it rouses the shades to greet you, all who were leaders of the earth; it raises from their thrones all who were kings of the nations.
All of them will speak and say to you: 'You too have become as weak as we! You have become like us!'
Your pomp is brought down to Sheol, the sound of your harps; maggots are the bed beneath you, and worms are your covering.
"How you are fallen from heaven, O Day Star, son of Dawn! How you are cut down to the ground, you who laid the nations low!
You said in your heart, 'I will ascend to heaven; above the stars of God I will set my throne on high; I will sit on the mount of assembly in the far north;
I will ascend above the heights of the clouds, I will make myself like the Most High.'
But you are brought down to Sheol, to the depths of the Pit." Is. 14:9-15.
Now Nick, I know that one of your other idols, an old Catholic false teacher, also known as one of the "early church Fathers", taught that Satan was going to be redeemed, and that you believe that there's such a thing as Purgatory, like he did, for good old Satan, but when one ACTUALLY reads the Words of God, as written in the Bible (God's Own Words), not the Pope's~ one can see clearly that Satan is going to Sheol, which God also refers to here as the Pit.
You can try and change the meaning and intent of His Words, but as I said~ you're going to be held accountable for it, along with the Papists.
Your Papist pals who tortured and murdered my Christian brethren for six centuries, because like me, they also REFUSED to bow the knee to the false and disgusting teachings of Catholicism.
I hope you repent.
Oh, and as to your deceitful, lying "pal" Ken here?
Today he says he's a Baptist, but on other days he says he's a Catholic. He also knows that Catholicism is a joke. I've posted his e mail to me here before, since he has seen fit to lie about me here repeatedly and therefore it is here where I will repudiate and expose his vileness.
I'll post it again. after you read it, and see that he's actually in agreement with me concerning your false Religion, will you say he's a Bigot? Will you say he is lying about your Religion? Will all your Papist Troll pals join you in this?
Ah, no you and they will not because you enjoy his hypocrisy. If he were to be honest and truly Christian, he would tell you the truth to your faces, that Catholicism is a false Religion, and that by adhering to it you are an idolator, who obeys the Pope and not the Word of God.
_______
From: Ken
Subject: Re: My post on am spec tonight
Date: January 20, 2010 7:37:34 PM EST
To: vicandmargie
I was just teasing our resident whiner...Alan. Sorry, the joke just didn't come off. oops heh.
You may not realize it (heh) but I put down our resident "catholic pompous ass" all the time.
Just any time I refer to his church...I call it simply the "Roman church". If you want to prick his balloon that is all that is necessary (evil smile). You can also refer to the statues of the "Saints" in Rome being nothing more than the old Roman gods (little g) with new signs painted on their feet.
(I know...I have seen them in person. little plaques glued tackily on those beautiful carved marble statues.)
Roman church members just absolutely detest being called (correctly by the rest of Christendom) as nothing more than idol worshippers.
Heh, I must warn you though, the insult kicked off one of the "Crusades" though I have forgotten which. It is a killin' insult I delight in when a so-called catholic (which means universal, by the way),
uses the word "catholic". I simply tell them..."No No...I'm in the CATHOLIC CHURCH! You are in that Roman idol worshipping cult from Rome".
Use the insult sparingly, however. Just say "Roman Church". They usually get the message.
You will note that JP NEVER screws with me any more.
God loves you, lady.
Papist Dan| 11.10.11 @ 4:43PM
BIGOT ALERT !!!!!BIGOT ALERT!!!!!!
The mad Mullah Margie has returned from her one week of exile to favor us again with her bigotry.
She doesn't believe in the divinity of Jesus,but she pretends to lecture us on Christianity again
Nick| 11.10.11 @ 8:05PM
Margie,
"You don't DEAL with me, kiddo."
How about, "I tolerate your misconceptions"? Is that better?
"[...] and that you believe that there's such a thing as Purgatory, like he did, for good old Satan [...]."
Wrong. I don't believe Satan is in Purgatory, and the Catholic Church has never taught this error. But, your precious Martyrs Mirror has very nice things to say about Origen, remember?
"[...] one can see clearly that Satan is going to Sheol, which God also refers to here as the Pit."
The Pit is not the same as Sheol. The Pit is Gehenna, i.e., the lake of fire, the place of damnation. Try reading all of the book of Isaiah. Also, Jeremiah and Ezekiel, to learn about the Pit.
"You can try and change the meaning and intent of His Words [...]."
I would never do any such thing. It is not my fault that you are ignorant of the meaning of God's Word. Study this subject some more, please.
And, please, do not try and involve me with your spat with Ken, thank you.
God Bless!
Margie| 11.10.11 @ 10:35PM
LOL. You tolerate my "misconceptions", do you?
Well, God doesn't tolerate liars and deceivers.
And that's what you are, and persist in doing.
And if you believe in the false teaching of Purgatory, which ISN'T in the Bible, you are calling God a liar.
He teaches no such thing as a place we go to "become purified".
And, if you do not think Satan can be redeemed then you have utterly contradicted yourself, because the Scripture says that is where he is going.
Sorry Nick the Papist, but God makes it clear, as He always does, thankfully when He says this: "..but you are brought down to Sheol, to the depths of the Pit."
You can try and twist it all you want, but anyone that isn't into deceiving themselves and can read, can understand what He says there.
What part of "to Sheol, to the depths of the Pit" do you not understand, Nick?
And no one who goes there has any chance of redemption, much less returning from there.
I'm not the ignorant one, Papist punk.
Nick| 11.11.11 @ 12:10AM
Margie,
"You tolerate my 'misconceptions', do you?"
Yes, it takes much patience, which I try to ask God for, constantly. Sometimes I fail to ask. For those times, I apologize.
"He teaches no such thing as a place we go to 'become purified'."
The souls in Sheol were not there to be purified. I should have been clearer, I'm sorry. Sheol was the abode of the dead, and seems to have had two stations, or states of existence: The Bosom of Abraham and the Pit.
The Pit was for the condemned, like the rich man, in the parable of Lazarus and the rich man (Luke 16:19-31). The saints of the Old Testament were in the Bosom of Abraham. They could not enter Heaven until Christ's Death and Resurrection.
The chasm between the two was impossible to cross, as Christ taught. In Christ's time, the Pit was also called Gehenna, which is what it is called in the New Testament.
"And, if you do not think Satan can be redeemed then you have utterly contradicted yourself, because the Scripture says that is where he is going."
I'm not sure what you are trying to say here. Could you elaborate a little?
"You can try and twist it all you want, but anyone that isn't into deceiving themselves and can read, can understand what He says there."
I'm not twisting anything. And, yes, please do some reading about the Jewish concept of Sheol and the Pit. It is very interesting. You will learn much.
What was this "prison" where Christ preached the Gospel to the dead, if Sheol is the place of damnation? The damned have no hope of redemption, so, Christ wouldn't have preached the Good News to them. It can't be Heaven, because Heaven is not a prison. So, there has to be a third place, no?
"What part of 'to Sheol, to the depths of the Pit' do you not understand, Nick?"
I understand it better than you do, I'm afraid. Sheol is not the same as Gehenna, i.e., the lake of fire, the Hell of damnation. On this point, you are indeed ignorant.
God Bless!
Nick| 11.10.11 @ 8:19PM
Margie,
I forgot one thing.
" [...] will you say he's a Bigot? Will you say he is lying about your Religion?"
Straw man. I don't you call you a bigot, do I? Nor, do I say that you are lying about my religion. I say that you are mistaken, severely mistaken, about the teachings of the Catholic Church. I don't believe you are knowingly lying.
You just refuse to be taught. In some cases you are willfully ignorant. But, when I do show you that you are wrong, which is often, you should not keep on repeating your mistakes. Don't you agree?
God Bless!
Margie| 11.10.11 @ 10:47PM
As usual, you have avoided reality. It doesn't matter what Ken has actually said about your Religion, does it? It doesn't matter to you that he's a flaming liar and hypocrite, and false accuser.
As long as he kisses your rear end with "niceties" and false hope (you are being deceived by what you believe), that's good enough for you.
Meanwhile, while he, along with your disgusting lying Troll pals here disparage me and constantly lie about what I believe, Ken is the one who is actually hating you, as he does not speak the truth to you.
If he were a true brother in Christ, he would tell you the truth.
And you're a blatant liar. I refuse to be "taught" your Papist doctrines. Of course I do. They are an abomination to God. I will rather be tortured and burned at the stake, along with my brethren in Christ by the likes of your ilk, than to ever submit in ANY way to anything but the true Gospel of Jesus Christ.
Jesus says that anyone who preaches another gospel is accursed.
I hope you repent.
"I am astonished that you are so quickly deserting him who called you in the Grace of Christ and turning to a different gospel-- not that there is another Gospel, but there are some who trouble you and want to pervert the Gospel of Christ.
But even if we, or an Angel from Heaven, should preach to you a gospel contrary to that which we preached to you, let him be accursed.
As we have said before, so now I say again, If any one is preaching to you a gospel contrary to that which you received, let him be accursed." Gal. 1:6-9.
Nick| 11.10.11 @ 11:42PM
Margie,
Again, I'm not interested in getting dragged into your spat with Ken.
You implied that I call you bigot and liar, which I haven't. I just want the record clear. You should want the same thing.
"And you're a blatant liar."
Show me where I have lied? Bearing false witness is against God's Commandments, remember?
"I will rather be tortured and burned at the stake [...]."
I don't think you have to worry about this, do you?
"Jesus says that anyone who preaches another gospel is accursed."
Yes, Margie, this should scare you enough to make sure you are actually preaching His Gospel. This takes fervent prayer to the Holy Spirit.
Please, pray often, for the gifts of the Holy Spirit.
God Bless!
Margie| 11.11.11 @ 12:37AM
Burning at the stake~ you're already doing it here, creep.
I never asked you to enter into a spat, game player. I posted Ken's own words for you to see where he's really at concerning your phony Religion.
And as far as actually preaching His Gospel. I do. I post His Own Words, and do not ADD TO THEM as you do.
Repent, Papist, and believe the TRUE Gospel of God.
Beginning with Mk. 1:1.
Nick| 11.11.11 @ 1:30AM
Margie,
"Burning at the stake~ you're already doing it here, creep."
Really? You think that you are being burnt at the stake? Plus, I love you, my sister in Christ.
"I post His Own Words, and do not ADD TO THEM as you do."
Straw man. I do not "ADD" to God's Word, and never have. I, like you, continuously post Sacred Scripture.
God Bless!
Christopher| 11.11.11 @ 11:06AM
Nick, Margie has a weird persecution complex as you can see by the reference to burning at the stake. She believes fifty million ,50,000,000, were killed by the Papacy! She views herself as a martyr and she is not even a Christian since she doesn't believe in the divinity of Jesus.
Margie| 11.11.11 @ 11:56AM
Papist liar:
I see. Sooo, your constant haranging and name calling and lying about me and what I believe is considered exactly what?
BIGOT NOT A CHRISTIAN DO NOT BELIEVE IN THE DIVINITY OF CHRIST.
Just what do you call that, you despicable scumbag?
Hell awaits you, liar.
Unless YOU repent, and believe the true Gospel of God, as I do.
Papist Dan| 11.11.11 @ 4:49PM
Bigot Margie,
It is the truth Mullah, you do not believe in the divinity of Jesus so you aren't a true Christian. How is that a lie, scumbag Margie? You can't deal with the truth so you call everyone a liar. Go back under your rock.
Nick| 11.14.11 @ 1:09AM
Christopher,
I'm well aware of this. Believe it, or not, we were friends for the past two years that she has been posting here, at AmSpec. I know her arguments well.
God Bless!
Jacob R| 11.9.11 @ 9:42AM
What church do you go to? I can explain for you how it would be impossible for your tiny little fractured intellectual lightweight of a church to exist if it hadn't been for the Bride of Christ.
The entire world sends diplomats to the Pope. NO ONE takes tiny evangelical churches seriously because every member has their own dogma and it's rarely coherent. But keep bickering about the details and only agreeing on bigotry towards Catholicism while Catholics continue to lead worldwide Chrostianity for all intents and purposes (the real reason you hate us so badly...the proof is in the pudding and you can't handle how bad yours tastes)!
Margie| 11.9.11 @ 12:20PM
"Everyone transgressing and not abiding
in the doctrine of Christ does not have God.
The one abiding in the doctrine of Christ,
this one has the Father and the Son.
If anyone comes to you and does not
bear this doctrine, do not receive him into
the house, and do not speak a greeting to
him.
For the one speaking a greeting shares
in his evil works." 2 Jn. 1:9-11.
Rich D| 11.12.11 @ 2:43PM
Straw man alert! Practices are not dogma. Churches that recite or hold to the teaching of the Nicene Creed (not the first creed) are within the fold. Countries that send diplomats do so because the pope is a head of state, not because they agree to his claim to be the head of the church, which existed long before that heresy arose.
If you are going to quote an aphorism, at least get it right. It's, "The proof (test) of the pudding is in the eating." You misunderstand the word "proof" and appear uneducated.
And no, you are not hated - you are corrected because you are loved and other wish to bring you to the truth of the Gospel unpricked by the thorns of error.
Ryan| 11.9.11 @ 11:19AM
The problem here for Protestants is that if Christ's work on the Cross is complete, then purgatory is unnecessary. Nothing in scripture points to the ability of any person to be able to enter God's kingdom, because NONE of us are clean.
I Cor 5:16-21 "16 Therefore from now on we recognize no one according to the flesh; even though we have known Christ according to the flesh, yet now we know Him in this way no longer. 17 Therefore if anyone is in Christ, he is a new creature; the old things passed away; behold, new things have come. 18 Now all these things are from God, who reconciled us to Himself through Christ and gave us the ministry of reconciliation, 19 namely, that God was in Christ reconciling the world to Himself, not counting their trespasses against them, and He has committed to us the word of reconciliation.
20 Therefore, we are ambassadors for Christ, as though God were making an appeal through us; we beg you on behalf of Christ, be reconciled to God. 21 He made Him who knew no sin to be sin on our behalf, so that we might become the righteousness of God in Him."
If I am "reconciled" and have the "righteousness of God," then why do I need to be purged? Where in scripture does it point to anyone with a little sin being allowed at a halfway point like purgatory? How can Christ's work not completely deal with someone's sin?
Christopher| 11.9.11 @ 11:38AM
Ryan,
I don't understand your position. Are you saying because Christ died on the cross then all my sins are forgiven? So Hitler and Stalin and Mao's sins of genocide are forgiven and they go straight to Heaven provided they somehow "reconcile?" What does that mean to reconcile?
Ryan| 11.9.11 @ 11:57AM
I'm not arguing the universalist/absolute reconciliation point here, no. Belief is required, which results in repentance. I doubt Hitler/Stalin/Mao ever repented in this life of their sin.
Also, check the language in the verses above - we don't reconcile ourselves. God reconciles us to Him through Christ's atoning work.
As John 3:16-18 says, " 16 “For God so loved the world, that He gave His only begotten Son, that whoever believes in Him shall not perish, but have eternal life. 17 For God did not send the Son into the world to judge the world, but that the world might be saved through Him. 18 He who believes in Him is not judged; he who does not believe has been judged already, because he has not believed in the name of the only begotten Son of God."
Christopher| 11.9.11 @ 12:19PM
Ryan, not clear on what you are saying. It would be easier if you say what you mean rather than citing some verses.
How does God reconcile Hitler, Stalin, and Mao to Himself?
Are you saying if these three, or anyone, repents then they go to heaven? I guess it all depends on your meaning of repenting.
Ryan| 11.9.11 @ 1:16PM
"Belief is required, which results in repentance. I doubt Hitler/Stalin/Mao ever repented in this life of their sin." It's likely they are not reconciled to God.
Repentance means turning from sin and deciding to live differently. In a sense, had Hitler admitted that all of his actions were wrong and truly believed in Christ, and sought to live for Christ from some point forward, then he would have been reconciled to God. THAT'S how far His Grace can reach, and THAT'S how much sin Christ's death can cover.
I'm not sure if there is another way to look at repentance.
The apostle Paul is an extremely good example - he was killing and imprisoning Christians, and repented and followed Christ. God reached down and reconciled Paul to Himself.
Christopher | 11.9.11 @ 3:33PM
St Paul repented and then lived a full life devoted to God, and was martyred because of his faith. There was faith as evidenced by his deeds. You cannot compare him to Hitler/Stalin/Mao.
How can you show repentance unless you change your way of living and show it by doing "good deeds?" The problem I have with Protestatism is the concept of repentance only without evidence of that repentance by deeds.
Ryan| 11.10.11 @ 8:55AM
I don't blame the hesitance here, and scripture is kind of silent on the matter of the deathbed confession. All I can point to is the matter that we are ALL sinners, even if we aren't all Hitlers, and our sins separate us eternally from God, no matter what level they are.
Rich D| 11.12.11 @ 2:24PM
That is a straw man, Chris, and not the reformed position. There is no concept of repentance without evidence.
Ryan is only comparing them to Paul before he was redeemed. All of them could have been redeemed, also. Their works would be evidence of faith.
It is possible that one can truly repent and be saved without the evidence of works if one were to die shortly after being saved, and we would not know that. It also possible that one of limited mental and physical capacity could be saved and not be able to do any works at all. It is for God alone to judge the heart.
Nick| 11.9.11 @ 4:56PM
Ryan,
"If I am 'reconciled' and have the 'righteousness of God,' then why do I need to be purged?"
Because, even when God forgives my sins, in the Sacrament of Penance, and I return to a state of grace, i.e., God's grace and friendship, I still have the punishment, due to my sin, attached to my soul. Now, we can begin this purging in this life, through the grace of God, by doing extra acts of penance.
Divine justice demands that I pay some price for my offenses against God. This is the "building with hay and wood" that Saint Paul talks about in 1 Cor. 3:15. It is building on the Gospel of Christ with inferior materials.
"Where in scripture does it point to anyone with a little sin being allowed at a halfway point like purgatory?"
In several places. In the parable about Lazarus and the rich man (Luke 16:19-31,) Christ tells us that there were two places where the dead dwelt: The Bosom of Abraham and the Pit of Hades, i.e., Gehenna, the lake of fire, Hell.
Christ also tells us that blasphemy against the Holy Spirit cannot be forgiven in this life, or in the next (Matt. 12:31-32). So, some sins, or, rather, the punishment of sin, can be forgiven in the next life.
Saint Peter tells us that Christ preached the Gospel to the "spirits in prison," i.e., "to the dead" (1 Peter 3:19-4:6). Heaven is not a prison, and, the souls there have no need to hear the Gospel. There is no benefit to preach the Good News to the damned. So, this prison had to be a third place. It was called Sheol in Hebrew.
"How can Christ's work not completely deal with someone's sin?"
Christ's sacrifice does. Eternal punishment for our sins are completely forgiven, when we make a good act of contrition. We are restored to communion with God.
But, again, Divine justice requires that we make restitution to God, that we pay our debts and "accept this temporal punishment of sin as a grace" (CCC 1473). All sin stain our souls, just as original sin did before baptism. This residue of sin, i.e., the temporal punishment due, must be removed before we enter Heaven.
In this way, we are made perfect, so that we may see God face to face and participate in God's Divine Sonship. If we are made perfect, by the grace of God, in this life, we go straight to Heaven at the moment of death, to participate in the Heavenly liturgy of the New Jerusalem, i.e., the Wedding Supper of the Lamb (Rev. 19-22).
God Bless!
Christopher | 11.9.11 @ 5:30PM
Great work, Nick.
Nick| 11.9.11 @ 6:05PM
Thank you, Christopher.
I appreciate your kind words.
God Bless!
Margie| 11.9.11 @ 5:33PM
Complete and utter baloney, not to mention utterly unscriptural.
Catechism pap.
Repent and believe the Gospel of God.
Nick| 11.9.11 @ 6:08PM
As I've already stated to you, Purgatory is entirely Scriptural. For those who have eyes to see and ears to hear.
God Bless!
Margie| 11.10.11 @ 1:25PM
To ALL genuine Christians here:
Why is it that you do not address Nick?
Why is it that you do not love him and therefore correct him?
Are you ALL a bunch of cowards?
How sad.
Christopher| 11.10.11 @ 2:33PM
Margie,
Since you apparantly do not believe in the divinity of Jesus why do you try to pass yourself as an authority on Christianity when you do not believe the most basic tenet of Christianity?
You believe in Arianism, which is your right, but don't confuse what you believe with Christianity.
Margie| 11.10.11 @ 7:17PM
Excuse me? I believe nothing of the sort, liar.
Go crawl back under that rock you and your lying pals came out from under.
God throws liars like you into Hell for what you are doing.
It isn't a very nice place, you know?
And contrary to Catholic doctrine, it's forEVER.
Christopher| 11.10.11 @ 9:04PM
Margie,
Make it simple: Do you believe in the divinity of Jesus? Do you believe that Jesus is God?
From all your posts, you don't.
Instead of resorting to calling everybody a liar, answer the questions.
Margie| 11.11.11 @ 12:00PM
Name calling? You mean like you constantly do to me here?
Let's make it simple, PUNK:
Liars are thrown into Hell by the God of the Bible, the One in Whom I place my trust for my deliverance.
"..there is no discharge from war, nor will wickedness deliver those who are given to it." Ecc. 8:8.
A snake is a snake is a snake, and that's what you are. Jesus wasn't afraid to call a snake a snake, nor am I.
Got it, PUNK?
Papist Dan| 11.11.11 @ 4:52PM
Bigot Margie
Your one week in exile has not improved you. Same old Mullah, same language liar, punk,
Go crawl back under the rock you were at for a week.
Why did you come back here?
skip| 11.10.11 @ 4:57PM
"I will establish my covenant as an everlasting covenant between me and you and your descendants after you for the generations to come, to be your God and the God of your descendants after you" (Genesis 17:7)
Purgatory pales in comparison to the reality that the Jews are God's everlasting chosen people, yet believe Jesus Christ is a prophet, not the Messiah.
~
"For where two or three gather in my name, there am I with them" (Matthew 18:20)
Differences as to how best to worship the Lord Jesus Christ, the only Son of God the Father Almighty, pales in comparison to the reality that Jesus desired we gather together in His name.
~
"Let the word of Christ dwell in you richly as you teach and admonish one another with all wisdom" (Colossians 3:16)
We cannot in reality possibly be free, have the free will to in reality choose our own words and actions, if God explained His will to us so clearly even a liberal could understand it; intelligent and honest differences in belief over purgatory pales in comparison to a comprehensive understanding of both the Old and New Testaments of the Bible based on reason and experience.
~
"Heaven and earth will pass away, but my words will never pass away. No one knows about that day or hour, not even the angels in heaven, nor the Son, but only the Father" (Mark 13:31-32)
Purgatory pales in comparison to heaven and earth, and not even Jesus knows when earth will pass away, much less heaven.
~
"Oh, the depth of the riches of the wisdom and knowledge of God! How unsearchable His judgements, and his paths beyond tracing out! Who has known the mind of the Lord? Or who has been His counselor?" (Romans 11:33-34)
Jesus Himself, not knowing when earth will pass away, apparently did not know this depth; intelligent and honest differences in the belief as to how best we understand God pales in comparison to being as intelligently and honestly prepared as we are able based on reason and experience.
~
"I saw satan fall like lightning from heaven" (Luke 10:18)
Jesus did not know this depth, but did witness the expulsion, from heaven, of satan; intelligence and honesty, based on reason and experience, leads to the necessity of having a proper perspective about both this world and the next.
~
"Jesus answered, "I am the way and the truth and the life. No one comes to the Father except through me" (John 14:6)
Intelligence and honesty, based on reason and experience, leads me to conclude that catholics and protestants both strive sincerely to come to the God the Father Almighty through His Son Jesus Christ, our Lord.
Margie| 11.10.11 @ 6:33PM
Sincere doesn't get one to Heaven. And sincerely deceived doesn't either.
Jesus says if you love Him, you will keep HIS WORD.
Sorry, that's what HE says.
If you care one whit about Nick, or anyone for that matter, you won't let him go away thinking it's OK to believe a false gospel.
Papist Dan| 11.10.11 @ 6:59PM
Margie, you are not a Christian because you do not believe in the divinity of Jesus. We don't need lectures froma phony.
Margie| 11.10.11 @ 7:12PM
Truth isn't your forte, is it, punk? "Dan".
skip| 11.10.11 @ 7:02PM
May the word of Christ dwell in you richly as you teach and admonish in all wisdom.
Margie| 11.10.11 @ 7:11PM
skip,
So, it's that hard for you to actually love another individual, whom you refer to as "brother?"
You have that much of a problem with right from wrong, and are that lukewarm that you can't even say that there's no such thing as Purgatory?
You see fit to allow your so called brother, who is believing a false gospel, to go on like that?
What a hypocrite.
Heh, the verse, "Am I my brother's keeper", fits you well.
skip| 11.11.11 @ 3:46AM
Margie,
Coward, hard to love another, lukewarm, hypocrite: absolutely. Based on purgatory specifically: perhaps.
At funerals, hearing of the departed looking down from above, is a difficult concept to clarify based on scripture.
Purgatory is difficult to clarify based on scripture, but is a more vague and nebulous concept than those addressed by the Ten Commandments and the Resurrection.
~
"Things that cause people to sin are bound to come, but woe to that person through whom they come." (Luke 17:1)
"I tell you, my friends, do not be afraid of those who kill the body and after that can do no more. But I will show you whom you should fear: Fear him who, after killing the body, has power to throw you into hell." (Luke 12:4-5)
"For with the measure you use, it will be measured to you." (Luke 6:38)
~
To fight the entire war is unrealistic. I choose to fight the battles that have the clarity of right from wrong based on the Ten Commandments and the Resurrection.
Margie| 11.11.11 @ 12:18PM
So, let me get this straight, skip. You're admitting you're a coward, a hypocrite, and a lukewarm Christian?
OK, then quit throwing the hypocritical stones at me for speaking biblical truth.
Instead, you ought to study His Word, wake up spiritually and take up your cross.
There IS no neutral.
If you actually pray, read the Bible and fellowship with other Christians, and have the Holy Spirit within you, you can understand the Bible, and you would know that there is no such teaching as Purgatory in the Bible.
Unless of course, as the Bible says, you fail to meet the test~ that is, you never received His Spirit. If you haven't, then you need to ask Him, Who gives freely to all who thirst.
Your last paragraph is an utter cop out, as I'm sure you know.
You're allowing yourself excuses to not go to war, spiritually.
Catholics who are taught the false teaching of Purgatory are then led to believe an utterly false gospel.
One that believes wrongly, that no matter what one does, they will end up there and then go on the Heaven, no worries.
This is a lie and utter deceit, and against the Word of God.
IF you're a Christian, you'd know this, and you'd care enough about Nick, or anyone else who believes it, to tell them they are believing a lie.
I know it's hard, because you'll have all kinds of abuse heaped upon you and you'll lose all your pals (so-called) here.
Ken will accuse you of being like Clint the scumbag, and a hater, and a Pharisee.
He will probably seek to DESTROY you here.
And his friends, the lying Trolls will say you aren't a Christian, but a Bigot.
Yet, just which Master is it that you serve?
The Truth? Or are you a slave of Men?
So, while you are content being a coward and all that you admit to being, I REFUSE to be same.
And so spare me the judging, as indeed those verses you quoted therefore apply rather more to you, than to me, do they not?
skip| 11.11.11 @ 2:55PM
Yep, I admit I'm a sinner, and that I sin all too often.
Yep, I admit among all my sinful tendencies, I all too often lack the courage of my convictions. Despite this, I somehow summoned the guts to show you the courtesy of an actual response to you after you have implored Christians to address the topic under consideration.
Yep, I admit among all my sinful tendencies, I all too often find it hard to show love for another. Despite this, I somehow found it in my heart to not only respond to your implored request, but addressed the topic you have been engaged in, not only for Nick's general fund of knowledge if he so chooses, but for any other who chooses to peruse my ramblings.
Yep, I admit among all my sinful tendencies, I all too often am lukewarm on topics that I should be red hot about. Despite this, I somehow found the prerequisite warmth to not only respond to your implored request, but addressed the topic du jour with as much intelligence and honesty, based on reason and experience, as I could muster, courage-wise and compassion-wise.
Yep, I admit among all my sinful tendencies, I all too often reveal myself to be a hypocrite. Despite this, in my response to your implored request I had the courage to provide that addressed the topic of the day to others with some degree of compassion and with some degree of zeal, I realize among all my sinfulness that I all too often display, I will be judged by Jesus Christ, including how I have not been my brother's keeper.
Have mercy on me. I will try to be less sinful, including being more brave, loving others with more ease, exhibiting more fervor, being more sincere, and being a better steward to my siblings. After all, I have an abundant fear of the one who has the power to throw me into hell.
Papist Dan| 11.10.11 @ 6:57PM
Bigot Margie,
Nobody adresses Nick because he is a rational intelligent person. You are irrational and stupid. Go back to your private Catholic bashing with your pal Kenny.
Margie| 11.10.11 @ 7:33PM
Quit taking many screen names and repeatedly lying here and you just might get taken seriously, Troll.
Papist Dan| 11.10.11 @ 11:15PM
Bigot Margie,
I am using the name you call me, Papist and Dannyboy,
Your one week exile has not improved your vocabulary, still with papist, punk, liar.
And you pretend to be a Christian when you don't believe in the divinity of Jesus.
You are the Mullah of your cult of which you are the only member and head Mullah.
Go back under that rock, we had a nice week without your bigotry and stupidity.
Buzz off, Mullah.
skip| 11.10.11 @ 10:57PM
Margie had no problem understanding I addressed Nick, and I daresay it required almost none of her intelligence or honesty. With your obvious abundance of both, it is remarkable you couldn't figure that out.
Rich D| 11.12.11 @ 10:34AM
Take it easy. I can't be here all the time - I have other things to do. Nick's view of the non-existent purgatory is completely wrong. We are clothed in the righteousness of Christ which is imputed to us. We live in him and he in us. The Roman sect has erred on this for centuries, and have woven a tight web of twisted teachings on it that there is practically no verse left safe from misinterpretation.
I spent several weeks with Nick already. He doesn't appear to be open to anything that varies with what he already thinks that he knows.
It would be better if you would not go down into the gutter to fight his heresies.
Nick| 11.14.11 @ 1:04AM
Rich D.,
"Nick's view of the non-existent purgatory is completely wrong."
A mere assertion, on your part.
"He doesn't appear to be open to anything that varies with what he already thinks that he knows."
I'm completely open to any argument, if it makes sense. I have answered your objections. You, on the other hand, have not answered mine. I'm still waiting, in the other thread.
I would say that it is you isn't open to anything that disagrees with your preconceived notions. Is this why you suggest to other not enter into a conversation with me?
God Bless!
Rich D| 11.15.11 @ 8:40AM
Nick: "Is this why you suggest to other (sic) not enter into a conversation with me?"
When?
Nick| 11.15.11 @ 7:20PM
Rich D.,
Um, a couple of comments above, at 11.12.11 @ 10:34AM:
"It would be better if you would not go down into the gutter to fight his heresies."
I also see that you have no response to my Greek, from yesterday. Do you, therefore, concede the point?
God Bless!
Rich D| 11.16.11 @ 10:15AM
The comment was referring to the method used, not the activity itself. What's with your reading comprehension?
Nick| 11.17.11 @ 1:01AM
Rich D.,
Well, I'm glad you cleared that up.
I see that you still have no response to my Greek, huh? And, to add to that, you have no answer to my question about Colossians 1:24, from yesterday?
Rich D| 11.15.11 @ 9:54AM
What thread?
I think that it would be more accurate to say that you have responded, but not answered.
Nick| 11.15.11 @ 7:30PM
Rich D.,
The thread in which you objected to the Catholic Church's teaching that baptism is required and is salvific. Did you forget already?
The same thread where you claimed that Saint Peter meant angels, instead of spirits (which is the word that he used,) in 1 Peter 3:19, among other assertions.
Rich D| 11.16.11 @ 10:39AM
Nick: "I'm completely open to any argument, if it makes sense."
A mere assertion on your part.
" I have answered your objections. You, on the other hand, have not answered mine. I'm still waiting, in the other thread."
That is incorrect. I gave you many verses where baptism is not mentioned and the reason that any work makes grace not grace. I also said that I was done with that thread because you chose to ignore that argument, instead insisting that your reading of the two verses that mention baptism is correct. You ignored the context surrounding the verses and the Greek that I offered with references. That tells me that you are only serious about defending the indefensible. Better scholars than you have tried and failed.
So, OK, continue to twist them to support the heresies of your sect - it really doesn't matter to me. You are doing it again above so that you can argue that tradition is still exists in oral form just so that you can hang on to the comfortable heresies that the Roman church uses to hold Christians captive to the presumed authority of the ONE TRUE INERRANT CHURCH and its VICAR on earth the rest of us can go to hell. Paul was speaking in the context of his day and the teachings were being captured and preserved.
Yesterday, I was reading a book by a frenchman on the detailed events of the St. Bartholomew massacre. First the king said convert or die, but he quickly changed his mind to, "God's Death! Kill them all!"
Nick| 11.17.11 @ 1:12AM
Rich D.,
"I gave you many verses where baptism is not mentioned and the reason that any work makes grace not grace."
And, I countered, with many verses of Scripture, to support the Catholic Church's position.
"I also said that I was done with that thread [...]."
You stated that a few times, yet, you kept coming back. You didn't seem to be serious.
"So, OK, continue to twist them to support the heresies of your sect - it really doesn't matter to me."
Twist them? I'm not the one who claimed that Saint Peter was talking about angels, when he irrefutably used the word spirits.
"You are doing it again above so that you can argue that tradition is still exists in oral form [...]."
It's not my argument, it's Saint Paul's.
"[...] the rest of us can go to hell."
I've never stated that you, or anyone else, was going to Hell. Another straw man.
God Bless!
Dannyboy| 11.9.11 @ 7:52PM
Margie, why did you return, you said you were outta hers.
Ryan| 11.10.11 @ 8:39AM
"Because, even when God forgives my sins, in the Sacrament of Penance, and I return to a state of grace, i.e., God's grace and friendship, I still have the punishment, due to my sin, attached to my soul. Now, we can begin this purging in this life, through the grace of God, by doing extra acts of penance."
Several scriptural misconceptions here. When we come to Christ, we are ALWAYS under a "state of grace." Nothing points to us really being able to leave it. That's the whole POINT and MEANING of Grace - completely undeserved, completely unearned, and given when we cannot and do not deserve it.
Romans 8:1 "Therefore there is now no condemnation for those who are in Christ Jesus. 2 For the law of the Spirit of life in Christ Jesus has set you freefrom the law of sin and of death. "
The I Cor 3:15 interpretation has contextual issues. Paul is speaking in the passage about other Christian leaders who may or may not be discipling good believers well. Making it into a point about purgatory is a BIG stretch of interpretation.
Matt 12:31-32 has similar issues. It's just a stretch of scripture to apply it in that manner, and the interpretation there may be better put "in this age, or in the next" rather than "life." It puts a new perspective on the whole thing when it's a time period rather than a life-or-death thing.
I Peter 3:19-4:6, honestly, no one has claim on what that passage means at ALL. It's so confusing and indefinite in light of the rest of scripture, maybe outside of the OT/Hebrew concept of Sheol (which is unlike the Catholic purgatory), that any definite application is automatically suspect.
" Divine justice requires that we make restitution to God, that we pay our debts and "accept this temporal punishment of sin as a grace" (CCC 1473)."
Christ paid this restitution IN FULL on the Cross. Period. "It is finished." As I pointed out earlier, there's a lot more weight in scripture which points to Christ dealing with our sin AND its punishmentin its entirety than some of the dubious issues you have presented here.
Rom 5:10 For if while we were enemies we were reconciled to God through the death of His Son, much more, having been reconciled, we shall be saved by His life. 11 And not only this, but we also exult in God through our Lord Jesus Christ, through whom we have now received the reconciliation."
"Reconciled." Not "partially reconciled." If we could add ANYTHING to our redemption, to our reconciliation with God, there would be no need for Christ's sacrifice, because it renders it insufficient.
Grace is, and always has been, about our inability to deal with our sin on any level. We cannot reconcile ourselves to God.
Nick| 11.10.11 @ 8:11PM
Ryan,
My objective was not to convert you to the Catholic Church's position. Only to show you that we base our belief in Purgatory on the Sacred Scriptures, as well as Sacred Tradition.
If you read the early Church Fathers, you see that they wrote about Purgatory. So, the first Christians, as well as those who followed, past down this teaching.
I can't answer all of your objections, right now. I will try later tonight.
God Bless!
Margie| 11.10.11 @ 10:51PM
The so called early church fathers also believed that Bible believing Christians deserved to be tortured and killed because they refused to believe in the false teachings (that they made up and are not in Scripture) such as "Purgatory."
Repent, and believe the true Gospel of God.
Nick| 11.10.11 @ 11:32PM
Margie,
Name one Father of the early Church who believed what your bogus claim. You can't. Because you don't know the history of Christianity.
Margie| 11.11.11 @ 12:44AM
I know church history, pal. Especially the history of the murderous Popes for six centuries.
You deny it, and even say that the martyrs were heretics. You're a Papist through and through.
Repent and believe the TRUE Gospel of God.
Beginning with Mk. 1:1.
Nick| 11.11.11 @ 1:21AM
Margie,
"I know church history, pal."
Not as much as you think you do.
"You deny it, and even say that the martyrs were heretics."
Not martyrs like Saints Ignatius and Ireneaus.
Margie| 11.11.11 @ 1:36AM
Right, but the rest of Christianity who rejected the Popery and who were put to death by them~ THEy were all heretics, right, Nick?
All but your precious two.
To show the readers what just one of my brethren went through, the Papal Inquisitor's "questioning" of her before they murdered her for rejecting the false teachings of Catholicism, to show how the same EXACT phony questioning, accusing, lying and hatred continues right here today, in these very pages by the modern day Papists who are destined to believe the deceit of the Devil and his minions, I am posting just one account of just one of the beloved Martyrs of God, that gave her life for the testimony of Jesus Christ.
Read it carefully.
Inq. is the disgusting Inquisitor, and Cl is the Christian sister.
CONFESSION OF A WOMAN CALLED CLAESKEN, WHO LAID DOWN HER LIFE FOR THE TESTIMONY OF JESUS, A. D. 1559
Questions and answers between the commissary and Claesken
The commissary first interrogated me concerning my name, the place I was from, my age, and other like things. He then asked me, "Are you baptized?" Claesken. "Yes." Copra."Who baptized you?"
Cl. "Jelis of Aix-la-Chapelle." Com. "The deceiver; he himself has renounced his belief. How did he do when he baptized you?"
Cl. "He baptized me in the name of the Father, the Son, and the Holy Ghost."
Com. "Where did you receive baptism?"
Cl. "At Workum, in the field."
Com. "Were there others present?"
Cl. "Yes." Com. "Who were they?"
Cl. "I have forgotten."
Com. "What brought you there?"
Cl. "I have forgotten."
I could truthfully give this answer both times.
Com. "Are your children not baptized?" Cl."My youngest two are not."
Com. "Why did you not have your children baptized?" Cd."Because I was satisfied with them as the Lord had given them to me." Com."Why were you so satisfied with Abraham and Sicke, and not with Douwe; you had Douwe baptized?"
Cl. "I did not know it then."
Com. "What did you not know then?"
Cl. "What I know now."
Com. "What do you know now?"
Cl. "What the Lord has given me to know." Corn."What has the Lord given you to know?"
Cl. "That I cannot find it in the Scriptures, that this ought to be."
Com. "How long have you not been to church?"
Cl. "Not for nine or ten years."
These are the questions which he put to me; but he used far more words, and when I did not readily answer him, he said that I had a dumb devil in me, that the devil transformed himself into an angel of light in us, and that we were all heretics. He then
Page 612
read to me the articles I had confessed, and said it should come before the lords, and that if I desired it, he would write it differently. I replied, "You need not change anything."
Questions and answers between the inquisitor and Claesken
Inquisitor. "Why did you have yourself baptized?" Claesken. "The Scriptures speak of anew life. John first calls to repentance, Christ Himself also, and afterwards the apostles; they taught the people to repent and reform, and then to be baptized. Thus did I repent and reform, and was baptized." Against this he did not say much.
Inq. "Why did you not have your children baptized?"
Cl. "I cannot find in the Scriptures that this ought to be."
Inq. "David says: 'I was shapen in iniquity, and in sin did my mother conceive me.' Ps. 51:5. Since children are born with original sin, they must be baptized, if they are to be saved."
Cl. "If a man can be saved by an external sign, then Christ has died in vain."
Inq. "It is written, John 3:5, that we must be born again, of water and of the Spirit; hence, children must be baptized."
Cl. "Christ does not say this to children, but to the adult; therefore did I become regenerated. We know that the children are in the hands of the Lord. The Lord said: -;Suffer little children to come unto me; for of such is the kingdom of heaven."' Matthew 19:14. Inq. "The household of Stephanas was baptized, which probably also included children." I Cor. 1:16. Cl."We do not depend on probabilities; we have the certain assurance." He did not say much against this either. Ing. "What do you think of the holy church?"
Cl. "I think much of it."
Inq. "Why then do you not go to church?"
Cl. "I think nothing of your churchgoing." Inq."Do you believe that God is Almighty?"
Cl. "Yes, I believe this."
Inq. "Do you then also believe that Christ consecrates Himself, and is present in the bread? Paul says: 'The bread which we break, is it not the communion of the body of Christ? And the cup which we bless, is it not the communion of the blood of Christ?"' I Cor. 10:16. Cl."I well know what Paul says, and believe it, too."
Inq. ."Christ said: 'Take, eat; this is my body;' and Paul likewise." Matt. 26:26; I Cor. 11:24. Cl."I well know what Christ and Paul say, and thus I believe." Ing."Do you believe that Christ consecrates Himself, and is present in the bread?"
Cl. "Christ sitteth at the right hand of His Father; He does not come under men's teeth."
Inq. "If you continue in this belief, you will have to go into the abyss of hell forever. It is what all heretics say. Jelis of Aix-la-Chapelle has deceived you; he himself has renounced his belief, because he saw that he had erred." Cd."I do not depend on Jelis, or any other man, but only on Christ; He is our foundation, upon whom we have built ourselves, even as Christ teaches us in His Gospel: 'Whosoever heareth my words, and doeth them. I will liken him unto a wise man, who built his house upon a rock; and though storms come, and beat against the house, yet it will not fall.' Matt. 7:24. These now are the storms that beat against our house; but Christ is our stronghold, and He will preserve us."
Inq. "You do not understand it; there are many other writings, of which you know nothing."
Cl. "We need no other writings than the holy Gospel, which Christ Himself, with His blessed mouth, has spoken to us, and sealed with His blood; if we can observe that, we shall be saved." Inq."You should suffer yourself to be instructed; the holy fathers instituted churching* fifteen hundred years ago."
Cl. "The holy fathers did not have this holiness; these are human commandments and institutions. Neither did the apostles practice this holiness; I never read it." Ing. "Are you wiser than the holy church?" C1."I do not wish to do anything against the holy church; I have yielded myself to the obedience 61 the holy church." Inq."You should think: Do I know better than the holy fathers fifteen hundred years ago? You should think that you are simple."
Cl. "Though I am simple before men, I am not simple in the knowledge of the Lord. Do you not know that the Lord thanked His Father, that He had hid these things from the wise and prudent, and had revealed them to the simple and unto babes?" Matt. 11:25.
At one time there were also two monks with him, who were to instruct me. They had but little to say, only that we were people of corrupt minds, reprobate concerning the faith, ever learning, and never able to come to the knowledge of the truth. I Tim. 6:5; II Tim. 3:7, 8. I replied, "When the day of the Lord will come, you will find it to be otherwise; take heed lest you then be of those who will say: 'These are they whom we had in derision; behold, how they are now numbered among the children of God, and their lot is among the saints."' Wisd. 5:3, 5. Then they said, "Behold, she judges us." I replied, "I do not judge you; but I tell you to take heed unto yourselves. Now our life is accounted madness, and our end to be without honor; but when the day of the Lord comes, it will be found quite different." The sum of the matter was, that I had a devil, and was deceived. I said, "Is Christ then a deceiver?" He replied, "No; Christ is no deceiver." I said, "Then I am not deceived; I neither seek nor desire anything else than to fear the Lord with all my heart, and (knowingly) not to transgress one tittle of His commandments." After he had talked to me still further, he said, "I can tell you nothing else; you may consider the matter." I replied, "I need not consider it otherwise; I know full well that I hold the truth."
When I came before him again, he said, "Claesken, to what conclusion have you come?"
Cl. "I have concluded to adhere to that to which the Lord has called me." Matt. 20:1. Ing."The devil has
* Den Kerck-gang.
Page 613
called you, who transforms himself into an angel of light in you people."
When he examined me the sixth time, he asked me, "When Christ held His supper with His apostles, did He not give them His flesh to eat, and His blood to drink."
Cl. "He gave them bread and wine, and He gave them His body for redemption."
Inq. "Christ certainly clearly says: 'Take, eat; this is my flesh;' you certainly cannot contradict this."
Cl. "Paul says: 'I have received of the Lord that which also I delivered unto you, That the Lord Jesus, the same night in which he was betrayed, took bread; and when he had given thanks, he brake it, and gave it to his apostles, and said, Take, eat; this is my body, which is broken for you; this do in remembrance of me. After the same manner also he took the cup, when he had supped, saying, This cup is the new testament in my blood: this do ye, as oft as ye drink it, in remembrance of me. For as often as ye eat this bread, and drink this cup, ye do shew the Lord's death till he come.' I Cor. 11:23-26. Thus Christ left us His supper, that we should remember His death by it, that He gave His body and shed His blood for us. This supper I want to hold with the people of God, and no other."
He held to his twaddle: that we must eat Christ's flesh, and drink. His blood, since these were clearly implied by the words of Christ and of Paul.
Cl."Since the words are so plain, I can well understand them; but it is as Paul says: that those who do not turn to the Lord, have a vail before their hearts; but those who turn to the Lord, from their hearts the vail is taken away. II Cor. 3:1416. We have turned to the Lord; nothing is hid to us."
Inq. "In the 6th chapter of John (verse 53) Christ also clearly says that we must eat His flesh, and drink His blood."
Cl. "It is also written there: 'Then the Jews murmured, and said: How can this man give us his flesh to eat? Then Christ said: Except ye eat the flesh of the Son of man, ye have no life in you.' Again, He says: 'Whoso eateth my flesh, and drinketh my blood, hath eternal life:' He also said: 'Flesh and blood profit nothing: the words that I speak unto you, they are spirit, and they are life.' Those who believe in God, and walk in all righteousness, they are temples of God, in whom God will dwell and walk, as Paul testifies." II Cor. 6:16.
When, he examined me the seventh time, he said, "Do you not believe that the apostles ate the flesh of Christ?"
Cl. "Christ took the bread, gave thanks, brake it, and gave it to His disciples, and His body He gave for their redemption." Ing. "Do you not believe otherwise?"
Cl. "I do not believe otherwise than Christ has spoken."
Inq. "Then I declare unto you, that I am clear of your blood; your blood be upon your own head."
Cl. "I am well satisfied with this."
Inq. "Herewith I commit you to the lord."
He afterwards examined me once more, and asked me, "Do you not vet believe that the apostles ate the flesh of Christ?"
Cl. "I have told you."
Inq. "Tell it now."
Cl. "I will not tell it again."
Inq. "Do you still persist in your views respecting baptism?"
Cl. "You certainly well know that the penitent ought to be baptized."
Inq. "This is true enough, if for instance a Jew comes, who is not baptized yet. Are you still of the same opinion in regard to infant baptism?"
Cl. "Yes."
Inq. "Do you not believe otherwise?"
Cl. "I do not believe otherwise than Christ has commanded."
Inq. "Then I declare unto you, that you will be tormented forever in the abyss of hell."
Cl. "How dare you judge me so awfully, seeing judgment belongs to the Lord alone? Acts 17:31. I am not terrified by this; I know better; when the day of the Lord comes, it will be found different."
I then asked him, "What does my husband say?"
Inq. "Your husband also still persists in his views; may the Lord enlighten you."
Cl. "We are already enlightened, the Lord be praised."
Concerning my baptism he did not say much, nor about infant baptism; but the whole of his talk was that we must eat the flesh of Christ, and drink His blood, and that this had been instituted fifteen hundred years ago, and that I was simple and had hardly once read the Testament through. I said, "Do you think that we, run on uncertainties? We are not ignorant of the contents of the New Testament. We forsake out dear children, whom I would not forsake for the whole world, and we stake upon it all that we have-should we run on uncertainties yet? We seek nothing but our salvation; you certainly cannot prove to us by the Scriptures, that we practice and believe one tittle against the Word of the Lord." But he only said that we had all from the devil, and that we were possessed of the devil of pride. I said, "We know that the proud are cast down from their seats." Luke 1:52. He talked so long, that he sometimes already fancied that I would heed him; hence I had to speak now and then, because I did not want him to think this; I could not bear to hear him speak so awfully against the truth.
A letter by Claesken to her friends according to the flesh, and also according to the spirit, written in prison, the 14th of March, A. D. 1559, at which time, or thereabouts, she, her dear husband, and her brother Jacques, were put to death for the testimony of Jesus.
Margie| 11.11.11 @ 1:55AM
http://www.homecomers.org/mirror/
Nick| 11.11.11 @ 1:23AM
Margie,
Plus, I see you couldn't name one Church Father.
As I stated.
Margie| 11.11.11 @ 1:48AM
God knows them all, and where they are right now, for eternity.
Anyone can do a search as the internet is now filled with information on the so called early church fathers, most of which were utter heretics, as they were the ones who first brought in the false and disgusting teachings that you now have sold yourself over to.
Such as "Purgatory".
And infant baptism, and Transubstantiation, and prayer to the dead... I could go on.
Repent, Nick, and believe the TRUE Gospel of God.
Beginning with Mk. 1:1.
"I tell you, No; but unless you repent you will all likewise perish." Lk. 13:3.
Nick| 11.11.11 @ 2:17AM
Margie,
"[...] as they were the ones who first brought in the false and disgusting teachings that you now have sold yourself over to."
Like Saints Polycarp and Ignatius, who were taught by the Apostles Peter and John.
And, Saint Ireneaus, listed in your precious Martyrs Mirror, which says that he was a Godly man.
Yes, I will believe those who were taught by the Apostles (like Peter, John, and Paul,) over people who wrongly claim to know better than these first Christians. Such arrogance.
God Bless!
Margie| 11.11.11 @ 12:24PM
Continued disgusting deceit from the Papist Nick.
I am the one who believes the Bible and ONLY the Bible.
You are the jerk who chooses to play games with Him, and go by the false teachings of Men.
Arrogance, indeed, PUNK.
Did you read the account of the sister in Christ who was questioned concerning her BIBLICAL Faith, Nick?
The Martyr who believed as I do, as ALL genuine Christians do?
The one who was murdered because she, as I, refuse to bow the knee to the lying Papists?
No, of course not!
You are one of them in spirit. you are a liar, and false accuser, a deceiver.
REPENT and believe the TRUE Gospel of God.
Beginning with Mk. 1:1.
JESUS CHRIST IS LORD.
Nick| 11.14.11 @ 12:52AM
Margie,
"I am the one who believes the Bible and ONLY the Bible."
Yes, and this is not Biblical. God never said to go only by the Bible, ever. Saint Paul said to follow their traditions. He also used Jewish traditions that were not written in the Old Testament.
"Did you read the account of the sister in Christ who was questioned concerning her BIBLICAL Faith, Nick?"
Yes, I did. If this story is true, she had plenty of opportunities to recant her heresy. She chose not to do so. The secular authorities executed her for it, not the Church.
God Bless!
Ryan| 11.11.11 @ 8:31AM
I get the argument, just pointing some stuff out.
One of the problems in the early Church, however, was they were still trying to figure everything out, and passed on a handful of traditions that may not have been scripturally sound (such as purgatory). All of the epistles in the NT were more or less working on theological problems in the early church. The Church Fathers didn't necessarily have it all together.
Nick| 11.14.11 @ 12:57AM
Ryan,
"One of the problems in the early Church, however, was they were still trying to figure everything out, and passed on a handful of traditions that may not have been scripturally sound (such as purgatory)."
Where is your proof for such a statement? Early Christians, like Saints Papias, Polycarp, and Ignatius of Antioch, where taught by the Apostles Peter, John, and Paul. Did all of them get the Gospel wrong?
I find that highly unlikely. Christ said He would be with the Church till the end of time (Matthew 28:20). Did Christ also get it wrong?
God Bless!
Nick| 11.11.11 @ 1:19AM
Ryan,
"When we come to Christ, we are ALWAYS under a 'state of grace.'"
Is this the same as once saved, always saved? Because, this is not Scriptural. We can always reject God, and His saving grace, because we have free-will.
"Nothing points to us really being able to leave it."
Christ makes it perfectly clear that we can lose our faith and salvation in the parable of the sower, in Luke 8:4-15. Romans 8:1 states plainly those "in Christ," i.e., in the state of grace.
I don't claim that the 1 Cor. 3:15 interpretation is crystal clear, but, it is hardly a "stretch" either. Again, I was just showing that it is possible to point to Scripture passages that refer to the concept of being "purged" as by fire.
"It puts a new perspective on the whole thing when it's a time period rather than a life-or-death thing."
I don't see how it changes the meaning that much. Either Christ was talking about when we die, i.e., the next life. Or, He was talking about Judgement Day, i.e., the next age. The point is that there are "sins" that can be forgiven in some future age or life. And one that cannot.
"I Peter 3:19-4:6, honestly, no one has claim on what that passage means at ALL."
The Catholic Church does, and has, for many centuries. So did the early Christians.
"Christ paid this restitution IN FULL on the Cross."
Yes, I have so agreed. Christ paid the price for our sins on the Cross, so that we don't have to suffer eternal damnation. But, again, we have to accept God's graces. Otherwise, we are doomed to sin and reject God, and end up condemned, by our own actions.
"'Reconciled.' Not 'partially reconciled.'"
Saint Paul is referring to being in a state of grace, when he writes reconciled. We lose reconciliation when we purposely disobey God. In fact, this is why confession is called the Sacrament of Reconciliation.
"If we could add ANYTHING to our redemption, to our reconciliation with God, there would be no need for Christ's sacrifice, because it renders it insufficient."
No, it is the other way around. Of course, we can't add anything to God's graces. But, we certainly can take away from His graces, by disobeying Him.
Purgatory is not a second chance. If you are in Purgatory, you are saved. You died in a state of grace. You just can't enter Heaven, i.e., the vision of God, until you are clean and pure.
This was the purpose of the ritual washing and being clean, or unclean, in the Old Covenant. These practices pointed to the reality of the Heavenly Jerusalem, which the New Covenant, in Christ's Blood, brought.
One had to be ritually clean to enter the Temple area, in Christ's day. Saint John tells us that in Heaven the Temple is God (Revelation 21:22). And we have to be clean to enter into the vision of God.
God Bless!
Ryan| 11.11.11 @ 9:08AM
Perseverance of the Saints (Once saved, always saved isn't the best way to put it) is completely and absolutely Scriptural. The NT repeats over and over how God keeps those who belong to Him faithful and does NOT lose them. I could quote verses in context all day long on the matter. Try I John 5 for a start, and take a close look into the theology from our side. God saves us, changes us, and keeps us.
How can I break something which God has done?
The sower parable in Luke 8 actually more proves my point - there's nothing that states that 3 of the 4 seeds were more than passing fancies. The Gospel has to "take root" truly for salvation - a flighty relationship with Christianity based on good feelings or just good works doesn't bring one into God's presence.
"We lose reconciliation when we purposely disobey God"
That means every time I sin, I become unreconciled. There's nothing in scripture that proves such a point. God reconciles me. It's HIS work...how can I undo that? Am I greater than God that I can break something He has wrought?
"This was the purpose of the ritual washing and being clean, or unclean, in the Old Covenant. These practices pointed to the reality of the Heavenly Jerusalem, which the New Covenant, in Christ's Blood, brought."
Except there's nothing in the OT that points to ritual cleansing and relates it to Sheol. At all. If there were a correlation, wouldn't have it been made in the OT?
Nick| 11.14.11 @ 12:46AM
Ryan,
"How can I break something which God has done?"
Because you have free-will, that's how. As all men do. Salvation is a process, not a one time event.
I disagree with your interpretation of the sowers parable, of course. Christ was clearly talking about those who have heard the word and believed.
"That means every time I sin, I become unreconciled."
Yes, if you sin on purpose with full consent of the will.
"Except there's nothing in the OT that points to ritual cleansing and relates it to Sheol."
I was not comparing ritual cleansing to Sheol. I was trying to show that ritual washing was required, even for the ritually clean, to enter the Temple area. This was a type of Purgatory, in the Old Testament.
Even those who were not unclean still had to go through ritual washing to enter the Temple. In the Heavenly Jerusalem, God is the Temple.
God Bless!
Rich D| 11.12.11 @ 2:46PM
Nick: "But, again, Divine justice requires that we make restitution to God, that we pay our debts and "accept this temporal punishment of sin as a grace" (CCC 1473)."
There is no way in heaven or hell that you can pay your debt! That is a heresy.
Nick| 11.13.11 @ 11:40PM
Rich D.,
Then, you must never have heard of redemptive suffering, huh?
Rich D| 11.14.11 @ 10:02AM
There isn't a Roman Catholic heresy that I haven't heard of.
Nick| 11.14.11 @ 8:33PM
Rich D.,
This teaching is not a heresy, it is taught in the Scriptures.
You may have heard of redemptive suffering, but you definitely do not understand it.
Rich D| 11.15.11 @ 9:45AM
Sorry, Nick. I do understand it. It is another doctrine of works. It's stunningly stupid to claim that one's suffering can remit for one's sin or the sins of another. This is heresy of the HIGHEST order and blasphemes the Holy Spirit and the work of Christ. You are hopelessly captured by the satanic influences in the Roman sect that has so tortured the meaning of grace that it is almost (but not quite) beyond belief.
Every heresy begins with a misconception of God, and the sect that you choose to belong to has been putting souls at risk for centuries. Many of them will be redeemed out of ignorance, but you seem to be a more than willing dupe.
Taught in Scripture? That's a satanic claim!
Nick| 11.15.11 @ 7:13PM
Rich D.,
"I do understand it. It is another doctrine of works."
This statement proves that you do not understand it.
Christ repeatedly says that we must "take up our cross" to serve Him (Matt. 10:38; Mark 8:34; Luke 9:23; etc.) Our cross entails participation in His Cross, which involves suffering. The Apostles and disciples did nothing but suffer in their mission to spread the Gospel.
Saint Paul constantly preached Christ crucified, along with sharing in His sufferings (1 Cor. 1:23; 1 Cor. 2:2; 2 Cor. 1:5-7; Phil. 1:29; etc.) This is why non-Catholics like to preach Christ risen, instead of Christ crucified. This is also why they prefer to display an empty cross, rather than a Crucifix.
If you understand this doctrine so well, explain Paul's words in Colossians 1:24, especially the emphasized part:
"Now I rejoice in my sufferings for your sake, and in my flesh I complete what is lacking in Christ's afflictions for the sake of his body, that is, the church [...]."
One has to know all of Christ's teachings in order to know what is Satanic, by the way.
"[...] but you seem to be a more than willing dupe."
Is this what you are down to, name calling? How lame.
God Bless!
Margie| 11.8.11 @ 6:49PM
"I will not set before my eyes anything that is base. I hate the work of those who fall away; it shall not cleave to me." Ps. 101:3.
StanO| 11.10.11 @ 2:01PM
The comparison between Catholics and Baptists is like the difference between a couch and a loveseat. Saying Mormonism is just another Christian sect is like saying a couch and a kitchen counter are the same thing. Just because they're both in a house, does not make them the same.
Patrick| 11.8.11 @ 1:06PM
No, they are children of the clothes dryer.
Mike| 11.8.11 @ 10:26PM
Did Jesus come to American and set up shop in Missouri?
Richard Baker| 11.8.11 @ 7:01AM
I suggest the atheists read St. Thomas Aquinas' "Five Proofs for the Existence of God." The thought that the physical universe just came into being spontaneously is absurd. The intricate relationships and order in everyday life didn't just occur by magic. These "scientists" who believe this rot are truly mental midgets, Hawking being the leader of the absurd.
Enzo L.| 11.8.11 @ 8:47AM
If there are gods out there, you can be assured that not one of them would be the god ignorant desert dwellers cooked up in Palestine thousands of years ago to rule over their contentious, barbaric peoples.
ferengi | 11.8.11 @ 9:57AM
Actaully that God has nore evidence than any other. Even the made made Gods like Alexander the Great et al.
Shamus| 11.8.11 @ 12:35PM
No one knows how the universe came into being.
You can make up any kind of story you like about the creation of the universe (as almost every culture has done) but evidence is lacking. Aquinas offers interesting arguments, but all they prove is that there is a degree of consistency in his beliefs. Dismissing ideas because they don't agree with your beliefs is what's really absurd.
Seek| 11.8.11 @ 3:27PM
Actually, the Book of Genesis bears a strong resemblance to magic -- or at least the desire among certain non-scientists to believe in it.
Doctor Right| 11.8.11 @ 3:58PM
What's a "non-scientist"?
Would that be someone who believes something that has never been proven to happen, and has no evidence to support it's foundation?
Like evolution?
If you want to debate I.D. versus evolution, then let's do it.
Quartermaster| 11.8.11 @ 5:57PM
I am a scietist, and I reject Darwinian evolution because it is not science. It's philosophy and was something that actually originated in ancient Greece among Philosophers there. It sure ain't science in any form.
StanO| 11.10.11 @ 2:03PM
Truly Hawking has an incredible mind, but in a very narrow path. He has made the mistake of assuming his intelligence included philosophy and theology . . . it clearly does not.
PaulyD| 11.8.11 @ 7:20AM
If life were found on other worlds, it would discredit the Bible utterly. Atheists know this. That is why they are so desperate to find it.
As Mr. Bethell describes, the discovery of life elsewhere would be strong evidence of creation by naturalistic processes. The alternative explanation for life elsewhere - that God created it - would not be a credible "apology" because it would be theologically inconsistent with scripture. That primary inconsistency derives from Man's fall in the Garden of Eden. At that time, Adam brought the whole creation down with him into death and decay. The Bible also tells us that the entire Universe will be detroyed (and then recreated in a new heaven and new earth) when Christ returns. Thus the fate of life elsewhere in the universe would be tied to our own. If other civilizations do exist, it would be difficult to defend the justice of God's destroying them for the sin of mankind.
Bottom line is no evidence of life has been discovered outside the earth's atmosphere whatsoever. And that remains, so far, further proof of the Bible's inerrancy.
Doctor Right| 11.8.11 @ 7:32AM
Life on supposed other planets would NOT discredit the Bible one bit.
If you think it would, please explain how?
PaulyD| 11.8.11 @ 7:48AM
Doctor Right,
Please reread my post and tell me what you don't understand.
Bob K.| 11.8.11 @ 8:05AM
Suggest you re write yours so we can tell what you understand.
Doctor Right| 11.8.11 @ 8:07AM
I think your first statement is an incorrect assumption.
Additionally, scripture says nothing about life on other planets. The Bible discusses THIS world, nothing more, and nothing less.
Therefore, as a Christian who believes that God created the universe and everything in it, I have no problem believing that there MIGHT be intelligent life on other planets, but the operative word is "might."
I have no basis from scripture to assume that there are other life forms "out there".
But if there is, I don't see how that validates Atheism, or evolution.
PaulyD| 11.8.11 @ 8:34AM
Alright, I'll try to clarify.
First, I see your point about my first statement. It's too absolute. There are probably many Christians who would be able to believe in Christ and also believe in life on other planets. Just as there are many Christians who believe the theory of Evolution can be harmonized with the Bible.
But I do not think one can believe both in the Biblical account of Creation and evolution. I think it is hypocritical. And so do Atheists.
Therefore, I believe that evidence of life on other planets would support the naturalistic process of creation, i.e., evolution, and give evolutionists more evidence to bolster their theory.
Now sure, there are plenty of Christians who could accept this. Just as there are many Christians who accept gay marriage, divorce, abortion, etc. even though these are all contrary to Scripture.
As to the alternative theory that God might have created life on other planets, ex nihilo, in the same way he created it here, it is IMPLIED that this would be inconsistent with Scripture because it would conflict with what the Bible says about man's history and his future. That history is that "Death" entered the Universe (which had been immortal) when Adam and Eve sinned. And that future is this Universe will be destroyed. It is therefore IMPLIED that God would have to destroy all life in the Universe when he destroys this Universe. If other intelligent life exists, they would have a history different from ours, perhaps without sin. And if they are without sin, why should they be destroyed when our time comes?
Doctor Right| 11.8.11 @ 8:50AM
I appreciate the thoughtful reply, but I still think you're making a lot of assumptions.
I understood your first post fine, BTW.
I still fail to see how life on other planets would tend to prove evolution. If that's your opinion, ok, and maybe it would cause some people to abandon faith for evolution, but that's not proof; that's an emotional response.
Additionally, I don't think we can make ANY assumptions about God's purpose for life on other worlds (if there is any). If God created us and loves us, than presumably he created and loves "them", too. Perhaps they have a plan for salvation, too??
It's all supposition, anyway. Fun to think about, and nothing more.
PaulyD| 11.8.11 @ 10:13AM
Yes, it is all supposition. We won't have to deal with this unless life is actually discovered.
Cheers, Paul
Anthony| 11.8.11 @ 3:18PM
If I may interject in this discussion, both Pauly D and Dr. Right restrict this discussion to the assumptions and constraints of Christianity.
If one were to subscribe to the thinking of deists, this discussion would be easily resolved.
If you assume a "superior intelligence" and designer that set the complicated and intricate forces of natual law into motion, to help the creation of life, as suggested by poster Mr. Baker, it is easy to believe that many other forms of life exist in the universe.
Consquently, if the Bible's version of creation and God is mere allegory, then the existence of life on other planets does not prove that the athiests have won the argument.
Having struggled with organized religion my entire life, deism appears to be the construct of God, life and the universe that makes the most sense.
Doctor Right| 11.8.11 @ 4:05PM
Creation in the Bible occurs before the advent of Christ's birth, death, and resurrection. So without getting into the oft-discussed idea that Christ was with God at the beginning, there's really not much difference between the Christian view of the origins of creation and that of a "Deist".
The difference that does exist is philosophical.
A Deist says God created the universe, washed his hands, and walked away. That view is not supportable, since it ultimately relies on evolutionary processes to initiate life, which is mathematically and scientifically impossible.
I don't believe that there are other forms of intelligent life in the universe.
However, I don't believe that there ARE NOT other forms of intelligent life in the universe, either.
I have no idea.
And if we look at scripture, it is absolutely silent on this issue, so there's really no way to reconcile the two ideas (aliens vs. the Bible).
So the answer to the question of "is there intelligent life elsewhere in the Universe?" can only be:
Maybe. Maybe not.
9thID| 11.8.11 @ 11:22AM
Did Christ have to be born of a virgin and die for their sins as well?
Doctor Right| 11.8.11 @ 1:32PM
Who knows..?
Margie| 11.8.11 @ 7:35PM
I always refer to the Bible to see what God says. Since it says that He created the Heavens and the Earth, then that's what He did.
I don't see the need to speculate, as some do. It's like the so called Christians who allow themselves to believe the lie of "Evolution", which basically is calling God a liar, since God says He created Man in His Image, and that He created everything else, and according to its kind.
Either God is telling the truth about what He did, or he's lying.
Each person is judging Him to be one or the other! God made sure He gave us all the info. we need. Some people cannot be satisfied with it, though.
Racer99| 11.9.11 @ 6:05AM
Actually beloved Margie, evolution is well supported in science when the word is used in it's true form. It simply means that a species will change over time in response to factors that cause variability in our environment. Using the term Evolved to describe the beginning of life is a lie form the beginning. This is the trickery used by the atheistic "scientists" so that can try to make other people loose faith in God (Bless Him Aways and forever). Yes, evolution of the species is generously supported by the fossil record, the second law of thermal dynamics, genetic research etc.
But the big lie is that this has nothing to do with how man or other living things first appeared on this planet. The proper term for that function is Creation or Origination, not Evolution. Scientists who first studied Darwin's observations jumped on the observable evidence of EVOLUTION of living things, and then allowed The Adversary to play on their ego and vanity as they all wanted to make the greatest scientific discover of all time, the supposed PROOF that God does not exist.
The real problem for the Atheistic scientists is the absolute and total lack of any significant evidence to support the accidental origin of life. There is also no significant supporting evidence that life has evolved from one species into another (like an ape to a man). Then there's the substantial genetic evidence that ALL of mankind descended from a single woman (sound anything like Genesis?) And there's those darned old pesky statistical analysis of the possibility that there was a random formation of DNA. The statistics indicate the odds that in some pile of goo all the right stuff, temperature, energy to do the work forming DNA , Then through in the unsupported that after forming this DNA it contained all the necessary codes for all life on earth? NONSENSE , the odds of the happening is a number that reaches extremely near infinity. Can't happen even in one spot in an infinite Universe.
Don't let Godless "progressives" trap you. Yes, evolution does seem to happen in living creatures over time but the chaotic, random CREATION of life simply cannot happen. It had to have been acted upon by a Intelligent Being that can only be described as Almighty God - Praise Him!
Margie| 11.11.11 @ 12:29PM
"Actually beloved Margie, evolution is well supported in science when the word is used in it's true form."
Pap.
Know what that means?
Garbage.
Beloved Racer99,
God says He CREATED.
Darwin says we evolved.
One's telling the truth and one's a liar.
You are judging God right this very moment.
I hope you repent.
StanO| 11.10.11 @ 2:07PM
Statistically of course, the two planets and the microscopic odds of life forming would be completely independent and equally dramatic, and equally point to a Creator.
Seek| 11.8.11 @ 3:29PM
So the Scriptures say nothing about life on other planets. That's kind of like saying the Scriptures say nothing about baseball or soccer. It doesn't "prove" anything one way or another. Argument by omission is no argument at all.
Doctor Right| 11.8.11 @ 4:11PM
You've inadvertently landed on a VERY good point.
For example, among Christian denominations, there is often disagreement on various points of doctrine.
Without getting into the whole denominationalism argument, I will say that the Church I attend uses the Bible in the following way:
Speak where the Bible speaks, and be silent where the Bible is silent.
In other words, if you see a clear example of "something", that gives you an idea of whether it's right/wrong, proper/improper, etc.
But if you DON'T see something, the only course of action is to err on the side of caution. You can't assume something is OK just because it's NOT mentioned.
That's why, from a religious standpoint, I'm completely neutral on the idea of life on other planets.
I have no idea. And it really has no relevance to my faith one way or the other.
LarryK| 11.8.11 @ 8:42AM
Doctor Who?
Moe Blotz| 11.8.11 @ 9:37AM
Doctor Who is phlying his phone box into the future whilst searching for Starship Enterprise.
Petronius| 11.8.11 @ 10:54AM
The Enterprisenextgen collided with RedDwarf. There is life in the Smegeverse.
Ryan| 11.8.11 @ 8:47AM
Actually, I would think that it could be the opposite, or inconclusive at best.
First is simply the odds of other life occurring. It's actually pretty staggering, and would point more toward deliberate design rather than accident. Two highly unlikely events which occur happen more due to purpose rather than accident.
Two, your argument about God's Justice is just as unfair toward the rest of mankind suffering for Adam's sin as it would be for extraterrestrial life. It's an inconsistent argument. Either God should have JUST punished Adam, or He should hold to the standard which meant that Adam's sin cursed all of creation.
If God is Who He says He is, then He is going to do what is right and just toward extraterrestrials. We don't get to define God nor determine how His justice is supposed to be handled.
Doctor Right| 11.8.11 @ 9:14AM
"Either God should have JUST punished Adam, or He should hold to the standard which meant that Adam's sin cursed all of creation."
Says who?
Are you presuming to second-guess God's judgment?
There are a lot of things in the Bible, particularly the Old Testament, which don't make sense to our human minds, but I'm not going to second guess God's decisions.
Ryan| 11.8.11 @ 10:37AM
Uhhh...no. I'm not. Read the last line in my post.
I think that you've kind of removed the statement from its context, which is the response to the argument that it would be unjust of God to place extraterrestrials under the curse of Adam.
I believe God is Just, and He defines Justice.
Maybe I wrote it poorly. I'm not trying to make a greater theological point.
PaulyD| 11.8.11 @ 12:40PM
Ryan,
Interesting comment.
To further clarify my argument, I believe the Bible states the entire Creation is under judgment, (through death) but since only mankind has an eternal soul, only mankind (not animals) pays the penalty of eternal death of that soul in the lake of fire.
I therefore believe it would be unjust of God to punish other creatures who had eternal souls unless those creatures had also rebelled against God.
Based on that logic, if extraterrestrial life only took the form of animal life, than perhaps it would be consistent for that life to fall under the curse of Adam just as the rest of our earthly creation does.
But again, since we haven't found any evidence of any of these types of life, the theological questions are just academic.
Doctor Right| 11.8.11 @ 1:33PM
How do we know that animals have eternal souls?
PaulyD| 11.8.11 @ 3:56PM
They don't. Does it read like I said they did? I am again assuming that sentient creatures like us would be created with them also. But then I guess sentient creatures could be created without them too, couldn't they?
Doctor Right| 11.8.11 @ 4:18PM
"Does it read like I said they did?"
It kinda' did, which is why I asked for a clarification.
This is one that always puzzles me. Take dogs, for example. They're not the most beautiful creatures God ever created, but there does seem to be something...special about them?
Perhaps I'm guilty of anthropromorphizing, but dogs, unlike any other creatures that we encounter on a regular basis seem to actually have personalities. They form bonds with their owners and other dogs, and are capable of expressing a wide range of emotions.
The best way to describe it is to say that when I look into a dog's eyes, I see something looking back at me.
If that makes no sense, then gaze into a sheep's blank, witless eyes one day and you'll understand what I mean.
So I always wonder...what IS "in there?" Does Fido have a "soul?"
My intellect says "no", he doesn't. He can't access salvation.
Then again, animals are completely without sin, right? I mean, how could an animal be dishonest?
So I don't know. They are sentient. But soul-less?
It's like with the aliens. I have no idea. I'll just wait to find out.
(FYI, I'm NOT a "dog person", and I haven't had a pet for over 20 years...)
Margie| 11.8.11 @ 7:57PM
Dr. Right (my brother in Christ),
Something very interesting I've discovered from looking at the original Greek language that the Bible was written in (as to the word soul).. it says in Gen. 2:7 that when God created man from the dust from the Earth and breathed into his nostrils the breath of life, that he became "a living soul."
In a watered down version (RSV), they removed the word soul, and replaced it with the word "being."
Amazing to consider that when God says soul, He meant a physical man... it changed the perception of what I always thought what was meant by that word, altogether.
I love studying His Words.. I've also found that in the Greek language on word can have different meanings depending on their application, as well.
For example, considering this verse in Gen. 35:18.
"And as her soul was departing (for she died), she called his name Ben-o'ni; but his father called his name Benjamin."
As always, God in His infinite Wisdom makes Himself (His Word) so amazingly interesting to us.
Praise His Name!
Margie| 11.8.11 @ 7:59PM
* should have said "one word can have different meanings" above.
IzeHavitt| 11.9.11 @ 12:04AM
Doc, You bring up an interesting point. Animals, like humans, do have a soul. In the Bible, soul life is breath life. According to Leviticus 17:11, "the life of the flesh is in the blood..." So animals have it as do humans. The neurologists might call it bio-electrical activity, or brain wave activity. But soul life can have limitations. Spirit life is another matter. Guys like Dawkins, Hawking, et. al. have soul lives and have arrived at their various (erroneous) conclusions by the exercise of their minds, based upon what their various source of references have been. It's a matter of sense knowledge vs. spiritual knowledge. This is why Jesus of Nazareth said to Nicodemus: "Ye must be born again..." The body and soul man or creature has limitations to it"s reasoning. He can be looking right at the answer, but not see it. He can behold the obvious, but can't acknowledge it. Those born again not only have body and soul, but the gift of holy spirit as well. However, it should be noted that that gift has to be developed and cultivated like anything else. .......On another note, a lot of the confusion regarding the Biblical account is due to a lack of an accurate understanding of the word "day ". In some cases, there is the phrase "in the day that, etc.etc." That can refer to a time period of undetermined length. On the other hand, "day " can also mean a period of twenty four hours. Much depends upon a given context of a passage.Here, too, many of the questions about this have answers that are right in front of everybody. You just gotta know how to see them.
THKrupp| 11.9.11 @ 12:31PM
Actually having spent a large portion of my life as a farmer and having a lot of contact with Cows, pigs, chickens and sheep. I disagree that they do not have personalities. All of these livestock have personalities. I still remember a pig that would try to knock me down every time I stepped into the pen. If you know how to read their facial expressions cows pigs and other livestock do indeed have personalities. I could always tell when a cow was about to try and stomp me into the dirt or if she was just bluffing as I worked with her newborn calf. You could see it in their eyes. I doubt they have deep thoughts like what is the meaning of life, but then who knows.
Racer99| 11.9.11 @ 6:57AM
I'd like to throw out an idea about original sin etc. Here is where as a devout Christian, I get a lot of grief from good practicing Christians. There has been a great deal of discussion in theological circles about how literal portions of the Bible should be considered One side says it's to be accepted as completely literal in every detail and others like myself believe a small amount of it is allegory or metaphor. The reason I believe this is because how would God, all-powerful and with complete knowledge of all things explain to illiterate man the "literal" way He created the universe. He couldn't couldn't explain the laws of physics He created and then explained how He brought them specifically together to create a world for man to live and receive a mortal body. I believe the six days God spoke of for the creation was to indicate that it was 6 specific amounts of time, etc. How would man in such an unlearned primitive state have understood to concept of 14 billion years ? I believe these allegories were used to impart important truths to mortal man in a manner that was true and man could understand to the capability of his existing intellect and life's references?
Basically this is why I do not believe we will be Judged according to Adam's original sin but only our own. We were Punished by being born in a sin filled hard to live in world rather than some beautiful perfect Garden, but it will be returned to it's former perfection after Christ returns in Judgement.
Margie| 11.11.11 @ 12:47PM
Just because Jesus taught in parables at times, doesn't make the Bible non-literal.
Common sense and having the Spirit of God inside of you enables you to tell the difference.
As to the days of Creation, He says after each day, "And there was evening and there was morning, the (blank) day."
All throughout the Bible there has been evenings and mornings, and sunsets and sun risings, have there not?
You're assuming He didn't mean what He actually said, and then that allows you to keep assuming all kinds of other things about what He actually says.
For example, you are assuming that Man was in a "primitive" state of some sort when God first created him.
And that's because you've been sold a bill of goods. You've bought into the phony theory of "evolution" that teaches that we were apes before we were man.
Yet, the God of the Bible says that He created Man in His Image.
Now, consider that for real! There is no way, if you are truly intellectually honest, which I think you want to be, that after really accepting that fact that we could EVER have been made from or "evolved" from a beast.
God made us in HIS IMAGE with all the reasoning capabilities He gave us in order to be able to know Him. Right from the very start.
You see, Racers, I've had my head in the Bible for almost 40 years, saved by the Grace of God and given His Spirit to dwell within me.
All I did was ask, humbly, on my knees. I promised to follow Him for the rest of my life, asked Him to reveal Himself to me, and He did, by His Spirit indwelling my heart.
Be like King David! Keep your head in the Bible, and by His Spirit you can then put on the "Mind of Christ", as it is written in 2 Cor. 2:16.
David loved God's Word. And His Words are what keeps us from believing anything that is false:
"How can a young man keep his way pure? By guarding it according to Thy Word." Ps. 119:9.
"I will delight in Thy statutes; I will not forget Thy Word." Ps. 119:16.
The Bible is God's gift to us. Our thoughts are not His thoughts~ His thoughts are in the Bible, and keep us on the straight and narrow.
ferengi | 11.8.11 @ 9:58AM
Not so - the Bible makes no reference to life elsewhere so its a non-issue Biblically.
ferengi | 11.8.11 @ 10:01AM
Wrong - life elsewhere would not be evidence of this because the origin of life violates the laws of nature and is a supernatural event by definition - you shoudl read "The Mystery of Lifes Origin" by Thaxton, Bradley and Olsen.
Stormzeye| 11.8.11 @ 4:27PM
If there is a God, and I believe there is, then why limit Him to one planet? As for evolution, who's to say that it has not been directed by God after life was initiated by Him?
john dubose| 11.8.11 @ 7:25AM
What we call "life" is actually super interesting chemistry and turbulence as played out while energy deteriorates from high density to low density. Whenever the environmental circumstances permit and there has been enough time, it will pop up. Modern religions are more manifestations of human desire to be important than a statement about "God".
Even so, this is all here and it had to come from somewhere. No matter how much science we learn, there is no way to put away the notion that there is big guy in the sky is looking for something from his more advanced physical manifestations ( that is still us at least for a while )
Doctor Right| 11.8.11 @ 8:21AM
"Whenever the environmental circumstances permit and there has been enough time, it will pop up."
There is no evidence to support this claim.
Yes, we have life here on earth. But despite the myriad forms, statistics will refer to that as "n=1".
In other words, no conclusions can be drawn about "the right conditions", etc.
Since Darwin's theory first emerged, those wanting to believe it have tried desperately to validate Darwin's claims, and they have all failed. Darwin's theory isn't even a theory; it's a hypothesis, and a shaky one at that.
In fact, Darwin's theory isn't much different from other bizarre 19th century pseudo-scientific theories like Phrenology, except that people still believe it.
DaveD| 11.8.11 @ 8:44AM
Evolution requires the broad "suspension of disbelief" - that's the same underpinning of modern science fiction.
Evolution is mathematically unsound. Evolution constantly requires things to occur in a specific sequence. Evolution repeatedly requires multiple simultaneous changes to occur in order for life to advance. Evolution rests it hopes a prayers on things that have been demonstrated to be false in the laboratory, but somehow actually worked out O.K. in the real world.
The only reason to accept this foolishness is the hard core denial of something greater than yourself. Non-directed evolution has no other basis in fact and observation other than faith. It is through faith, and only faith, that evolution remains dogma in the light of modern knowledge.
Malcolm from Minnesota| 11.8.11 @ 9:08AM
I am just dazzled by the wisdom of the theologeans who are posting this morning. Such wise men and women of God. There is nothing that you AmSpec theologeans don't know about life's mysteries.
Doctor Right| 11.8.11 @ 9:30AM
Rubbish.
What we DON'T know could fill volumes.
But this conversation isn't about what we DON'T know, it's about what we DO know.
And what we do know, from the world of science itself, tells us that evolution is not sustainable as a scientific theory.
Now...do you have anything to add to this discussion...
...or are you simply of the mind to lob metaphorical hand-grenades, feel self-satisfied in the delusion that you've actually said something of substance, and call it a day?
DRed| 11.8.11 @ 12:13PM
The world of science tells you no such thing about evolution. I'm not sure why you think it does.
Doctor Right| 11.8.11 @ 1:35PM
Not sure I follow you.
Science MOST DEFINITELY tells us about evolution.
In fact, it tells us that evolution is false.
Evolution does not stand up to the rigors that "science" insists for proof:
1. It has NEVER been observed.
2. It cannot be reproduced.
3. There is NO evidence that it has ever happened.
"Science" must be consistent, at least with it's own rules, don't you think so?
DRed| 11.8.11 @ 1:42PM
Evolution has been observed. Numerous times, both in laboratories and in nature. There is an enormous mountain of evidence supporting evolution.
PaulyD| 11.8.11 @ 4:13PM
Nonsense. There are no laboratory experiments that "prove" evolution. Give me an example and I'll tell you where it went wrong.
DRed| 11.8.11 @ 4:29PM
Are you familiar with Richard Lenski's work with e. coli at Michigan State?
PaulyD| 11.8.11 @ 5:20PM
Oh, most definitely. 40,000 mutations and counting, to date right? So, have any of these E Coli mutations changed the E Coli into a different type of bacterium, such as a Tuberculosis bacterium? Or have they combined to evolve into a multicellular creature? No, he started with E Coli and he still has E Coli, albeit in a different form.
Change and mutation within a species is not evolution. Breeding a chihuaha into a great dane or vice versa does not prove evolution. They are both still dogs. When a breeder is able to breed a dog into a duck THEN you will have proved evolution.
DRed| 11.8.11 @ 5:30PM
Breeding a dog into a duck would take a bit more than 20 years. How long did it take to breed wolves into dogs? I suppose you don't believe that happened either.
PaulyD| 11.8.11 @ 7:53PM
DRed,
Wolves ARE dogs. I.e., they are part of the canine family and can be interbred.
Now I will assume you mean wolves "evolved" from dogs (or vice versa), and if that is what you meant, then we have a great illustration of where the confusion lies in the theory of evolution.
Evolutionists often mix up the terms "natural selection" and "evolution." When what they really mean is that natural selection is the process by which evolution occurs.
If we define natural selection as the process by which environmental factors in nature create conditions analagous to "artificial selection,"i.e breeding, then it is possible for nature to create a new breed of dog called a wolf or to turn a wolf into, let's say, a dingo.
The jump Darwin made was to say that these same environmental factors, could over time, change a fish into a lizard and a lizard into a bird or a mammal, etc. But there is no evidence to show that has occured in the past or is occuring now.
In fact it takes 76 distinct morphological changes to change a lizard into a duck. When you look at the tremendous diversity of life on the planet, you would think we would at least observe this process going on all the time. And when you look at the fossil record you would expect to find millions of these transitional creatures going through these stages in order to account for all this diversity. But everywhere you look in the world species are static. And the transitional fossils cannot be found.
So perhaps you might have some different examples you can use to support your argument?
DRed| 11.8.11 @ 8:54PM
But of course a lizard doesn't turn into a duck. Something very close to a duck turns into a duck. You obviously accept that genetic mutation happens. When you combine mutation, natural selection and geographically isolate a population you don't see how speciation would occur? The fossil record and dna evidence provide overwhelming evidence for descent from common ancestors. You don't think it's odd that similar but distinct animal species share an enormous amount of dna? Claiming transitional fossils cannot be found is flatly not true. I think the famous example is the horse.
PaulyD| 11.8.11 @ 9:12PM
DRed,
How can you say "of course a lizard doesn't turn into a duck" when it is all the rage to say birds evolved from dinosaurs? Didn't you see Jurassic Park? :-) This is what Evolution IS for heaven's sake!
Yes, creationists accept genetic mutation, WITHIN SPECIES, otherwise it would not be possible for new breeds to be created.
I'm still waiting to be overwhelmed by your "overwhelming" evidence.
Glad you brought up the horse. Here, this article addresses most of the points you just raised in more detail than I have time for:
http://www.truthinscience.org......le/55.html
Enjoy. Out here.
Cheers, Paul
DRed| 11.8.11 @ 9:24PM
So there used to be dinosaurs. At that point, there weren't any birds. Now there are birds. Where'd they come from? Magic?
DRed| 11.8.11 @ 9:54PM
http://www.biblicalcreation.or.....cs146.html
What happened to Mr. Garner's references to the flood? He couldn't be trying to disguise his biblically derived creationist pseudoscience, could he?
Doctor Right| 11.8.11 @ 4:29PM
No, it hasn't.
Ever.
That's a complete fallacy.
Blue-eyed fruit flies and bacteria are NOT evolving. Change does NOT equal evolution.
Seek| 11.8.11 @ 3:31PM
So what? The Genesis-described Creation wasn't observed either.
Doctor Right| 11.8.11 @ 4:30PM
Yes, and that's why we call it "Faith."
If you choose not to believe something you didn't see, fine.
But be consistent.
Turn the mirror around, and stop insisting that others believe evolution.
Margie| 11.8.11 @ 7:41PM
You observe it every day of your life, Seek.
"For what can be known about God is plain to them, because God has shown it to them.
Ever since the Creation of the world His invisible Nature, namely, his Eternal Power and Deity, has been clearly perceived in the things that have been made. So they are without excuse; for although they knew God they did not honor him as God or give thanks to Him, but they became futile in their thinking and their senseless minds were darkened." Rom. 1:19-21.
Give thanks to him, Seek. He is worthy of your praise.
By the way, have you ever actually SEEN Constantinople?
IzeHavitt| 11.9.11 @ 12:12AM
To elaborate on a previous point: One can look right at the answers that are right in front of him and not see them. He cannot, or refuses to acknowledge the obvious. Why? It is written: "Only by pride comes contention." That's what drives the chronic unbeliever.
DaveD| 11.8.11 @ 8:31AM
And so many things have to fall in line in order to make your "super interesting chemistry" possible, much less actual that it boggles the mind. A single course in undergraduate Probability & Statistics will quickly show you how extremely unlikely all of this could have occurred without direction.
Religion has always understood this problem, and instead of being mere "manifestations of human desire to be important," are instead attempts to answer the key questions: Who done it? and Why?
Doctor Right| 11.8.11 @ 10:09AM
Funny, isn't it?
We already know the answers to both questions.
Who done it? God.
Why? Because He wanted to.
Appleby| 11.9.11 @ 7:09AM
Run down to Lowes, where all the materials needed to create a house are found, and call me the minute a three-story, four-bedroom two bath home with attached garage and fully finished basement spontaneously appears.
I will be waiting for your call.
c. j. acworth| 11.8.11 @ 7:44AM
An interesting book on this subject is "The Priviliged Planet". The main point is that while the probabalistic resources of the galaxy are huge, the number of conditions to be met for life to exist are even "huger". Thus, it is highly improbable that ET will phone us.
ncatty| 11.8.11 @ 12:39PM
Correct.
Kevin in Appalachia| 11.8.11 @ 7:46AM
Man has always asked for proof of God’s existence.
When man had primitive knowledge and a quest to find God he could look to the heavens and the earth and see what had been created. As man’s knowledge of the earth and science has grown over the years and with the development of new technology, his demands for proof of God’s existence has grown louder and more impatient. But with each new development it has been revealed to our eyes the complexity of nature and our universe. We now see things not even thought of 25 years ago. The telescopes and microscopes alone can dazzle the mind with their visions. Yet mankind continues to scream, “Where is God?” I answer, “Right under our noses.”
The argument is made in Scripture: "Through faith we understand that the worlds were framed by the Word of God, so that things which are seen were not made of things which do appear" (Hebrews 11:3). The things that we see (the natural) were made by things which do not appear (the Supernatural).
"For the invisible things of Him from the creation of the world are clearly seen, being understood by the things that are made, even His eternal power and Godhead..." (Romans 1:20). We see God's eternal power, His divinity, His being “Supernatural”, by the creation.
1 Corinthians 1:27 But God chose what is foolish in the world to shame the wise; God chose what is weak in the world to shame the strong;
Doctor Right| 11.8.11 @ 7:58AM
When Atheists and secular wise-men lime Dawkins or the late Carl Sagan bring probability into the debate about life on other planets, I have to laugh.
Clearly, none of these men, Drake included, have never looked at how utterly IMPROBABLE the existence of life on our own planet is, let alone wasting time looking for Vulcans, Klingons, and Wookies!
Darwin's theory works in complete opposition to the established laws of nature, which state that over time, order in a system decays (entropy), it does NOT randomly organize without an outside force influencing it's direction. That is contrary to physics.
At it's core, evolution claims that a long time ago (and that time period is unimaginably long on purpose), there was nothingness to the Universe. In fact, there really wasn't a universe at all...but despite this, there was matter, and it was all compressed into animpossbly small and impossIbly dense "cosmic pea". Evolutionists NEVER provide any explanation for the existence of the cosmic pea, but you're not supposed to ask because they all have PhD's next to their names, so they're much smarter than you and me. Remember: the 1st Law of Thermodynamics, something that none of these Wise Men would dispute, states that matter and energy cannot be created or destroyed, only interchanged, and that the total amount of matter and energy in the universe is a constant! So asking where the cosmic bean and it's matter came from seems reasonable, right? Good luck!
Then, the "cosmic pea" exploded; again, no explanation as to why it exploded, what force caused it to explode...nothing. Just accept it, and move on.
Then, after billions and billions more years, planets formed due to the Laws if Gravity, which also appeared out if nowhere.
Then...billions and billions more years later...again, unimaginably long to prevent you from debunking the theory...in a pool of chemical sludge, somewhere in Africa, probably, inanimate and unliving matter suddenly felt compelled to organize itself after being struck by lightning.
And then, the organized, inanimate matter somehow decided (without benefit if s brain) that it liked being organized, and golly gee, wouldn't it be swell to reproduce!
Now remember...reproduction is supposedly a biological imperative to maintain one's species. Well, what was so imperative here? Was something preying on the living sludge? If so, where did that come from? And what did the living sludge eat?
From that, we have beneficial"mutations" occurring all over the place, despite the laws if probability, and ultimately from that pile of living sludge we have over-worked cubicle mice sitting at their desks staring endlessly at Facebook...
Sorry, but that's not "factual", that's fantasy, and that's what evolution is -fantasy supportedby learned individuals (propped-up by Trekkies and attendees at the New York Comicon) who should know better, but in their hearts really don't want to believe in God.
And they say I.D. is unscientific???
Tina B| 11.8.11 @ 8:56AM
how Right you are, Dr.
Mac Jehoff| 11.8.11 @ 9:41AM
The Klingons have been found on the back side of Uranus.
Doctor Right| 11.8.11 @ 9:55AM
"On second thought, let's not go to Uranus...'tis a crappy place"
- with apologies to Graham Chapman
Doctor Right| 11.8.11 @ 9:55AM
"On second thought, let's not go to Uranus...'tis a crappy place"
- with apologies to Graham Chapman
Tina B| 11.8.11 @ 10:07AM
no, it was URanus.
Doctor Right| 11.8.11 @ 10:42AM
...Not goin' there...
Or is it too late for that?
Patrick| 11.8.11 @ 1:19PM
You must come with me, or you'll be late.
Sorry, if we are going Sci-Fi, the late Douglas Adams needs to be included.
Doctor Right| 11.8.11 @ 1:36PM
I was never a fan.
I got about 50 pages into "Hitchhiker's Guide" and put it down forever. It was just too dang...random.
Patrick| 11.8.11 @ 3:39PM
Funny thing about that. He was an atheist, so "random" had to be in there.
skip| 11.8.11 @ 5:31PM
The premise of the novel was so promising to me as to be a 'can't miss' classic book. Adams attempt was dreck. Unreadable.
Renaissance Nerd | 11.8.11 @ 11:49AM
I've always thought it very funny that Big Bang is supposed to be a proof that God doesn't exist. Let's see:
The whole universe expanded out of a superdense pea at unimaginable speed and proceeded to produce something like 2,000 stars per second from that time to this, each with a specific, definable life-cycle that can be quantified by human being, which also popped into existence over an amazingly short time considering the need for a billion intermediate species for each satisfied species.
This is evidence God DOESN'T exist? If it were true, I'd call it evidence He does. Unfortunately it's just a creation myth even more than the one they decry in the Bible. Simple truth is, no scientist knows how the universe came into being, and any hypotheses must remain so, because there's no way to test them. Big Bang is unjustly given the title of Theory along with Evolution, mainly because of the great desire to believe, which after all is the major prerequisite of faith. And then the Grand Master Hierophants of the Goddess of Luck wonder that some call their beliefs religious!
Patrick| 11.8.11 @ 1:26PM
Funny, since the Big Bang was a theory first proposed by Monsignor Georges Lemaitre.
Of course, it was panned by the scientific community as a foolish attempt at shoehorning God back into the universe. In fact, much of the current energy in physics today is to repair that gaping breach in the Materialistic narrative.
Patrick| 11.8.11 @ 1:33PM
I wonder if the search for life is also fueled by the fact that as good little Materialists, the fact that the Sun will not last forever, even if for a very long time, that there may well be nowhere safe to go. This is perhaps the most terrifying thoughts, for all their immortalized cleverness will be for naught.
Edward Cropper | 11.8.11 @ 8:03AM
The Fool has said in his heart there is no God. According to God’s word we are dealing with FOOLS here and the sooner we accept that fact the sooner we will stop being concerned with the mumbo jumbo they keep spouting. And stop trying to reason with the unreasonable.
For the believer in God who knows His reality with a certainty only a true believer can experience there is a joy unspeakable and full of glory.
The Lord Jesus who was God incarnate did not waste His time trying to reason out some non sensical solution to give to the fools He dealt with every day.. For those who know Him He is all the explanation we need.
If that sounds fairy tallish and too simple, so be it. The reality will only come to those who get over themselves and realize man-kind needs a Savior not a scientific explanation.
Kevin in Appalachia| 11.8.11 @ 8:26AM
While in generality I agree with you, Christianity requires reason and thinking. Jesus does not want people to be blind followers, but to demand proof. Acts 17:11 11 Now these Jews were more noble than those in Thessalonica; they received the word with all eagerness, examining the Scriptures daily to see if these things were so. Romans 10:2 2 For I bear them witness that they have a zeal for God, but not according to knowledge.
Doctor Right| 11.8.11 @ 9:53AM
I agree completely.
My conversion was not based solely on Faith, since my stubborn nature wouldn't allow it, so I approached it from a scientific perspective, and my conclusion was that the Universe could NOT possibly be a random event, and as a result, my Faith became stronger.
IzeHavitt| 11.9.11 @ 12:26AM
One other thing. There is a physics that we know very little about. There are various examples of it in the Bible. One could say that it's one of those "deep things of God " mentioned in I Corinthians. As it is also written: "The secret things belong unto the Lord, our God.".....Think about that.
Edward Cropper | 11.8.11 @ 5:12PM
We are not talking the same language. You quoted scriptures that deal with Spiritual understanding not scientific or human. He who has the Son has Life He who has not the Son shall not see Life but the wrath of God abides on him. Conversion has nothing to do with natural wisdom, be cause the things of God are not comprehended by the natural man
Intelligent Design| 11.8.11 @ 8:09AM
A really good book to read is: Signature In the Cell - DNA and the Evidence for Intelligent Design - by Stephen C. Meyer.
MOS was 71331| 11.8.11 @ 11:26AM
I agree. I read Meyer's book a few years ago, and his discussion of the complexities of DNA greatly impressed me with how unlikely it is that its structure is the product of chance.
Doctor Right| 11.8.11 @ 8:25AM
Another great book is "The Case for a Creator", by Lee Strobel.
ferengi | 11.8.11 @ 10:25AM
An even better book is "The Mystery of Lifes Origin", Thaxton, Bradley and Olsen - good evidence that life occuring naturalistically is a silly notion at best.
W| 11.8.11 @ 11:08AM
How about Frances Collins' "Language of God."
Evolution may explain development of life after creation, but it does not explain creation. Darwin stated there was a Creator.
KyMouse| 11.8.11 @ 8:30AM
Lots of people say that there must be life (conscious or not) out there because without it, space would be a waste of space. As a Christian, I accept that God spoke the universe into existence, and that it is filled with as much, or as little, life as He pleases. Who are we to say that He should have created more life?
Perhaps He has put great distances between us and other life forms so that we won't harm them with our sin natures.
However, it is possible that any other life forms out there are not benevolent, wise critters. The information about our planet and its location that we shot into space on board the Pioneer spacecraft in the early 1970s probably won't ever be intercepted by anyone, but there is the chance that other creatures might see us as food.
My favorite short story along these lines is Steven Millhauser's "The Invasion From Outer Space," which is at www.newyorker.com. Enjoy.
Doctor Right| 11.8.11 @ 9:47AM
This is where it gets fun!
There IS a lot of space in space, isn't there? Especially between us and...well, practically ANYTHING outside of our own solar system.
Interesting, isn't it?
Too often, when we dispute evolution, we only look at life forms on the earth, and we ignore the macro-proof.
For example:
1. On earth, H2O exists in all 3 states (gas, liquid, solid) naturally.
2. Any deviation from our current revolution around the sun wold cause abrupt and dangerous shifts in the H2) supply; too cold, it turns to ice, and we die; too warm, it melts, causing catastrophic floods, and we die; too-too hot, it turns to gas, and the resultant heat and humidity in the huge "greenhouse" would kill us all.
3. Only Earth has the proper gravity to maintain a viable atmosphere for biologic life.
4. Earth is a self-contained eco-system; all the forces of nature interact with each other to maintain the supply of water, especially fresh water, and that energy in the form of sunlight can be converted to food. Water from the oceans evaporates into clouds that form rain to feed plants, etc, etc.
5. Our sun, Sol, is just the right size and exactly the right distance away from us to sustain life without burning us or freezing us. The white/yellow light provides just the right amount of heat and energy. If it was a red sun, at our current distance, we could not survive.
The Sun’s mass not too large. If the mass of the Sun were a small percentage greater, it would burn too quickly and erratically to support life.
On the other hand, if the Sun were smaller, its greater flaring would disrupt Earth’s rotation rate.
Only two percent of all stars have enough metal content to form planets. Too much metal in a star will allow too many planets to form, creating chaos. Our Sun has just the right amount of metal for planets to form safely.
6. The solar system is in the perfect location in the Milky Way.
Our solar system is positioned thousands of light-years from the center of the Milky Way, near one of its spiral arms. This is the safest part of the galaxy, away from its highly radioactive center.
7. And what about the Milky Way Galaxy itself?
The Milky Way is spiral-shaped. Of the three types of galaxies—elliptical, irregular, and spiral— the spiral type is most capable of hosting human life.
Our Milky Way is enormous, measuring 100,000 light-years from end to end. However, if it were just a bit larger, too much radiation and too many gravitational disturbances would prohibit life like ours.
On the other hand, a stable Earth orbit that is necessary for life could not exist if our galaxy were slightly smaller. And a smaller galaxy would result in inadequate heavy elements, such as iron and carbon, essential to life.
...and it goes on and on...
The Universe screams "DESIGN!"
Who's listening??
KyMouse| 11.8.11 @ 9:56AM
I am, Doc. Thanks!
We also have a moon that has taken a whole lot of hits from space rocks that were headed for Earth -- I often think of that when I aim my telescope at the moon. Lots of craters that might have become craters down here.
Also -- correct me if I'm wrong -- it is significant that water expands when it freezes, instead of contracting, as other things do. One of my science teachers said that, but I can't remember why that property of water is so important. I hope you can remind me.
Doctor Right| 11.8.11 @ 10:12AM
Yes, only water has this property among chemical compounds, although there are some elements (so I'm told) that also share this property:
silicon, bismuth, antimony, gallium, and germanium
Rich Rostrom| 11.8.11 @ 8:35PM
The Earth has not been spared bombardment by large meteorites. There is plenty of geological evidence for large meteorite impacts on Earth, far more than on the Moon. But on Earth, the visible evidence is destroyed by erosion, buried by sediment, or destroyed by vulcanism. The Moon retains visible craters because it's cold and dry.
What evidence remains on Earth? Patterns of radiating fractures in deep layers of bedrock. For instance, there's a pattern of this kind centered on Des Plaines, Illinois, just NW of Chicago. In a circular area about 5 mi across, the bedrock is so broken up that well drilling was hit-or-miss, and the Deep Tunnel reservoir for the Sanitary District had to be routed at shallower depths than elsewhere. And the rock is riddled with "shatter cones" from the shock wave of the impact.
The Des Plaines impact was 280 million years ago. It's estimated that such events still happen about 4 times every million years - so there have been thousands in the last billion years.
As to the importance of water expanding when it freezes - that's why open water gets covered with ice. The frozen water stays at the top, and thus it melts when conditions warm. If ice sank, it would accumulate at the bottom of lakes and oceans, which would freeze solid.
oldfart| 11.8.11 @ 9:01AM
Watching Discovery and the History channel you get a clear understanding of the truly bizarre circumstances that had to occur for life, as we know it, to come into being.
Not just the chemical reactions that took place but the physical properties of the plant, and the planet’s formation, that set the stage for higher life forms to come into being.
It seems that life can come into being almost anywhere. There is almost no place on this planet that does not have life, from the deepest ocean trenches to the highest elevations.
Due to the vastness of the universe, even with probabilities of sentient life coming into being at near zero, it will happen. Now the frequency of sentient life, that is multiple occurrences, is open to question.
Is there sentient life, as we know it, out there? Most certainly. Will we ever make contact? Doubtful.
Also, we owe our survival as a species to survival of the fittest. That is most likely a universal truth. Do we really want to make contact? As Prof. Hawking has stated, the wide spread knowledge that the America’s existed was not very beneficial to the people already there.
ferengi | 11.8.11 @ 10:04AM
Actually the origin of life violates the laws of nature therefore its a supernatural event by definition.
oldfart| 11.8.11 @ 2:12PM
Not discounting influence of the supernatural at all. Just that the universe is without limit > if the possible occurrences are infinite then it is a certainty that the improbable will occur at some point in time.
Also remember that quantum mechanics does not rule out the possibility of multiple, simultaneous universes > if one universe is without limit and there are an infinite number of infinite universes then it is an absolute certainty that the impossible will occur.
ferengi | 11.9.11 @ 9:55AM
ferengi | 11.9.11 @ 9:55AM
ferengi | 11.9.11 @ 9:56AM
Incorrect sir - the universe is finite and therefore cannot contain a physical infinite.
abdullah shabazz| 11.8.11 @ 9:02AM
The chances of life forming?
Here's what Peer Reviwed Science says:
Hopelessly Inprobable
Its given in the new book by a top molecular biologist, Dr. EV Koonin, author of 400 papers, and lead resercher for the NIH's National Center for Bilogoical Information.
He says the chances that the simplest life can form naturalisitcally: 1 chance in 1,000,000,000,000,000, given the entire universe, and 14 billion years.
the likelihood that life would appear spontaneously is an unknown. (Some think it's close to zero.)
Tina B| 11.8.11 @ 9:02AM
Reality check, there will be an arrrival from "outer space" and that will be the return of Jesus Christ. He is coming from out there to here. There will be an invasion of an angelic army behind him, and a war will ensue.
For all you Trekkies and UFOlogists, it will be better than anything Georgel Lucas or Steven Speilberg could ever imagine, it comes from the hand of the Creator of all that we on Earth can see or imagine. People get ready.
Doctor Right| 11.8.11 @ 9:50AM
Interesting.
I don't think of Heaven as being in outer space. I think of it as a whole different dimension, completely inaccessible to this one (by us, at least).
Reconciling God with time and space was always difficult for me. I had to realize that He exists OUTSIDE of our perception of time and space; they have NO meaning to him.
Tina B| 11.8.11 @ 10:25AM
I like to tell people the Lord wears no watch and has no yearly calendar. He lives in Eternity, where there is no time or space, which exists only on earth. That we know of anyway.
I agree, I don't see Heaven as outer space either. It appears that Paul was caught up into a heaven while on earth, and John the Revelator may have experience a moment or two in Heaven inside his head or bodily. I can't wait to experience it, I can only imagine.
Doctor Right| 11.8.11 @ 10:41AM
"I can't wait to experience it, I can only imagine."
Best part?
No matter how amazing it is in our imaginations, the reality will be 1,000x better!
Kingofthenet| 11.8.11 @ 9:14AM
Physical laws DICTATE random isn't random. And what is GM Crops if not NEW human created life?
DaveD| 11.8.11 @ 10:00AM
No, no, no, no, no. No act of creation is involved in manufacturing genetically modified crops. This is simple alteration of existing biota.
If you take an old Model-T, remove the original engine and drop in a great big honkin' V-8 and add some flash, did you "create" a new car, or modify an existing car to make it different?
Doctor Right| 11.8.11 @ 1:38PM
Right!
If you want credit for "creating" life, start with the proper proportion of chemicals that make-up the human body (or a modified crop), mix it in a bag, zap it with 1,000,000 volts, and you get...
...Nothing.
It's not just about chemistry.
Rich D| 11.8.11 @ 10:28PM
Sorry - make your own chemicals.
God.
PNMNM| 11.8.11 @ 9:36AM
Because the theory of evolution demands the imperative of reproduction, it is remarkable that most of those who are only weakly reproducing themselves are those who believe in the evolution-without-cause faith. While I cannot cannot back that up with statistics, it is clear from the birth rates and the anecdotal reports that people of faith are having babies (I see plenty of multi-children families every Sunday). As for who is not having babies: Who is doing all of the aborting? Who takes the pill without a break? Who is for population control? Who ridicules the stay-at-home mom? I would bet that a survey would reveal interesting statistics about the religious breakdown of child bearing.
It seems that the first law of the pointless-evolution religion, to go forth and multiply, is violated in droves by the very advocates of its truth. Yet, the first commandment in Genesis, to go forth and multiply, continues to be observed by an ever dwindling segment of the "native" population and reinforced by God-fearing immigrants, legal and illegal. If one considers those who are subservient to the will of God as the meek, it is clear that they will inherit the Earth. The theory of evolution, meanwhile, will continue to be tweaked and, maybe, they will figure out how to include selfishness and self-centeredness in the equation.
Kingofthenet| 11.8.11 @ 9:45AM
Did you ever think that maybe the Atheists see how the Religious are over-populating the world, and decided rationally not to add to that overpopulation?
PNMNM| 11.8.11 @ 2:30PM
Yep, but that won't explain the behavior. The survival of the fittest and imperative to pass on one's genes would support the argument that the Darwinists are not the fittest. Your "altruistic" explanation for their lack of reproduction does not mesh with their true reasons. They don't have babies because the responsibility would get in the way of their self-centered pursuits. Their efforts might seem more altruistic if they were celibate, but that ain't the case. If you believe that the babies aren't coming because the parent-not-to-be wants to save humanity, I have a bridge that I think you would like to buy.
Doctor Right| 11.8.11 @ 10:37AM
You bring up an interesting point.
Human reproduction is HIGHLY inefficient. Gestation takes 9 months and makes the mother vulnerable to outside forces and internal changes. The mere act of delivery can kill the mother. The newborn child is absolutely helpless, and cannot take care of itself on it's own for several years, meaning the mother and father must spend inordinate amounts of time and energy finding food not only for themselves, but for their offspring.
Contrast this with the Praying Mantis, which gives birth to 100-200 eggs, all of which hatch completely formed (albeit small) and ready-t0-roll...or whatever it is that Mantises do...
...But WE'RE the dominant species on the planet???
HOW did that happen?
Hmmmm...Maybe it was someone's plan..?
Kingofthenet| 11.8.11 @ 10:54AM
Dominant but by NO means MOST successful. The LAST thing alive on this Planet is going to be a Cockroach sitting on a rock eating a piece of Lichen.
Doctor Right| 11.8.11 @ 11:06AM
Have cockroaches created civilizations? Sailed the oceans? Walked on the moon? Harnessed the power of the atom? Written sonnets? Painted the Mona Lisa?
Survival does not necessarily equal success.
We are the most dominant and the most successful species on this planet. No other species has left a mark so unmistakable as ours, and that was NOT the result of instinctive forces.
skip| 11.8.11 @ 1:38PM
Kingoftheegos,
You hypocrite. You constantly attack believers in the Creator, the Lord God Almighty, yet have the gall to state you believe with absolute certainty you will be the 'LAST thing alive on this Planet'. Sheesh.
Mike| 11.8.11 @ 4:41PM
Skip
Touche!
Mike Johnston
SFC USA (RET)
skip| 11.8.11 @ 8:15PM
Thanks.
Your powder dry?
Seek| 11.8.11 @ 3:35PM
There are plenty of liberal moms out there. Visit Reston, Virginia sometime. And if conservatives are the ones supposedly having all those kids, it appears Ann Coulter, Rush Limbaugh and several other people on the Right never got that memo.
Con Chef (NB) | 11.8.11 @ 9:46AM
Let's make this simple. Or as simple as it can be. I don't think that its a reasonable assumption that we're the only sentient beings in the vast infinity of space. But I also believe that G*d created the Earth & the universe as well. So as far as I'm concerned, if there IS life out there, it IS divinely inspired. Maybe G*d just hasn't seen fit to reveal these mysteries to us yet.
Doctor Right| 11.8.11 @ 9:51AM
"Maybe G*d just hasn't seen fit to reveal these mysteries to us yet."
Well said!
We cause ourselves needless anxiety when we try to understand the mind of G*d.
Rick| 11.8.11 @ 10:06AM
I find it strange that scientists like to discredit the notion of intelligent design. Whether or not there is life on other planets is a moot point. God could have created other life forms just as well as he created us. But the notion that there was nothing, and then nothing happened and nothing exploded and created everything is a crazier theory than believing in God. Take for example a computer program...we are intelligent enough to create programs that utilize what a computer can do. These "program languages" are always converted to binary code such as: 01010111011010010110101101101001
The computer uses the 1's and 0's as off and on switches in order to accomplish what ever you are trying to do on the computer, let's say like show a "K" on the screen. Now let's take a look at DNA sequencing, it's the same concept only instead of two characters that tell the computer what to do there are 4 here's a sample:
ATGCTTCGGCAAGACTAAAAAATA comparison to binary:
01010111011010010110101101101001
now DNA acts just like a computer program, it reads those sequences to know what kind of cell it is and what it's function is, can we possible think that this is just an accident of nature? The DNA sequence for a cell in your ear will always be a cell for "your" ear, no one elses, no other body part. Just as my sequence of binary code will always mean the same thing to my computer, I intelligently designed my computer code....where did DNA sequencing come from?
Doctor Right| 11.8.11 @ 11:04AM
Excellent point!
The quaternary-based DNA code is infinitely more complex than the binary code of computer "machine language"...
Yet no one doubts that computers were created.
And isn't it interesting that the same scientists who deny intelligent design nonetheless refer to the "DNA CODE"???
The mere use of the word "code" implies that it was created for a purpose!
Freudian slip..?
Tim the Enchanter| 11.8.11 @ 1:49PM
Not only that, there is a form of EDAC (Error Detection and Correction) built into the DNA code. Every time we think we have "discovered" or "invented" something, God was already there way before us.
Doctor Right| 11.8.11 @ 4:32PM
Yes, ask yourself "HOW would that have evolved???"
If the mechanism didn't already exist, the species would have never existed to begin with.
Vicky Lumentut | 11.8.11 @ 11:18AM
Maybe we are created by a bunch of programmers.
"Hey look, I created the most advanced A.I"
Of course, some of the A.I are not so intelligent that they roam the space in hope to find the creator(s).
Doctor Right| 11.8.11 @ 1:39PM
Isn't that the basis for Scientology?
Dixie Pixie| 11.8.11 @ 10:18AM
Gentlemen and Ladies.
It is easy to prove there is intelligent life in outer space.
The proof is they have the intelligence and good sense never to come near Earth.
Just look at the MSM and Entertainment garbage we beam to the stars daily.
Would you want to live near anyone of the seriously dysfunctional people the Entertainment Industry claims as “Must See TV”.
In short would any intelligent being want to live next to “Beavis and Butthead”?
The human race is lucky it is not being judged on the quality of its products or the photon torpedos would have all ready arrived.
Doctor Right| 11.8.11 @ 10:39AM
Interesting...
If an alien species picked-up a transmission of THE VIEW, they would conclude that we are a hideous, harpy-like, and violent species, prone to fits of rage and paranoia, with horrible, screeching voices and bizarre hair...
As a result, they'd steer WELL clear...
Petronius| 11.8.11 @ 11:06AM
Now I know why the saucers never land. When they do swing by, it's just to make sure there's nothing ready for launch at the Cape. And we are merely a parlor game for the Almighty.
Seek| 11.8.11 @ 3:37PM
"Fits of rage and paranoia" -- sounds like a Michael Savage broadcast.
Truth to Power| 11.8.11 @ 4:20PM
It sounds like Seek talking about Black people.
Dixie Pixie| 11.8.11 @ 4:38PM
And don't forget the OWS crowd and any Democratic Party rally plus a thousand other human events.
That is the point, why would any intelligent being live on Earth unless it was stuck here.
skip| 11.8.11 @ 5:46PM
...and they're ASTONISHED we're procreating unless by some unknown spontaneity and not by an act of choice...
Dixie Pixie| 11.8.11 @ 7:02PM
I am sorry Skipper, I did not get the joke.
I would personally horrified to learn that the MSM is in Obama-orgasms by announcing that the MSM anointed Messiah has made the next great leap in evolution by reproducing through budding.
To see the Socialist Messiah make the announcement at a MSM fawning press conference and have Obama standing there with half of a brand new Obama budding out of his side would be far too much to endure.
It would make a great Sci-Fi horror movie however.
skip| 11.8.11 @ 8:21PM
Greetings DP,
The 'joke' was meant as a continuation of Doctor Right's 10:39AM post.
I know, stick to the day job.
Kudos to the Doc for his posts in this thread.
skip| 11.8.11 @ 8:23PM
And, DP, if I have nightmares tonight I will know why, your scenario has certainly horrified me.
Dixie Pixie| 11.8.11 @ 9:54PM
Greetings Skip.
I still like Skipper better as it has a certain inherent majesty in the Navy way.
Sorry for the nightmares, but I thought my other option was even more horrifying.
I thought about going with your spontaneity in procreating riff by Obama breeding by spontaneous fission plugged into the above scenario.
Then I remembered that when planarian and tube worms do so they become ravishingly hungry as they have to make up the lost body mass.
As a result they are twice as hungry for double the number so they soon out-breed their food supply.
The thought of having a Sci-Fi move scene where at the Rose Garden press conference hundreds of thousands of Obama's wiggle out of the ground like bloodthirsty night-crawlers to feed on the MSM befuddled taxpayers was too much.
May I suggest reading more soothing literature like Mark Steyn's “After America” or maybe just hot cocoa.
Sweet Dreams.
skip| 11.9.11 @ 2:31PM
Aaargh.
If 'skipper' is to be the preferred moniker yours should henceforth be 'Dixie Idie Fixie'.
Mischievous, indeed.
As sure as God made little green apples the nightmare occurred, not of the anticipated film-ish 'Alien' variation, but of a wholly unanticipated genre much, much, much worse:
...hopelessly, perpetually stranded...with Irksem RCV Foulill III and wives Roseanne Barr and Rosie O'Donnell...and Professor Dory Lagius Meatius Hunky...and Margaret Figleaf ScienceGrant...and Susan Sarandon...not to mention Jharp Galligan, DRed Gelligan, Jack London Golligan, and Kingofthenet Gulligan...a 'democracy' was set up, whereby they each elected that I was not allowed to vote, as I would not have any time to do so, since I was elected to provide all food, water, and shelter, as was only fair...God, in His infinite wisdom, did not allow me to use either intelligence or honesty, and forbade I do any smiting whatsoever, even forbade I be inherently majestic...for a few moments the cranial echo chambers of 'Gelly', 'Golly', and 'Gully' triangulated, causing a radio transmission about an impending invasion by a massive extraterrestrial force, and I thanked God and His infinite wisdom, but nothing happened...
...it was horrible...
Dixie Pixie| 11.9.11 @ 9:09PM
Greetings Skip
Funny, I slept very well last night.
I went with the hot cocoa.
Better Luck tonight.
skip| 11.10.11 @ 12:47PM
Greetings 'Southern Mischievous' One
I dared not sleep. Tonight, I think I'll go with a single malt, but I don't know...
...the horror haunts...
Dixie Pixie| 11.10.11 @ 1:43PM
Greetings 'Skip'ping to the dawns early light.
What Horrors Haunts.
There are so many real ones coming from Obama and minions.
It is hard to prioritize while dreaming.
That is why I go with the hot cocoa.
Happy Dreams tonight.
skip| 11.10.11 @ 5:41PM
All mischievousness aside, the haunting horrors are indeed the real ones that may actually have this nation at the twilights last gleaming.
This 'Yankee Skipper' concedes to the inevitable: hot cocoa it is. Your insistence did it - that and the snow.
Kingofthenet| 11.8.11 @ 11:04AM
I will believe we will create Artificial life BEFORE Organic ones. Who cares if it's Organic anyway, people get Pig heart Valves, they don't feel any affinity towards swine, people get all sorts of mechanical implants, they don't feel like Borg. In fact while I believe Medical Science will improve, it doesn't fix all issues like fatal accidents. What you need is a digital/mechanical component. Given the above examples would it matter if one's brain could be replaced by a CPU? If it was undetectable to you and others as being 'different'? Obviously replacing the rest of the body would be no problem, but somehow people are attached to their heads. It would make space travel EASY, you could do dangerous activities with FAR less worry, if you died they could just 'restore' your last save.
trekin| 11.8.11 @ 11:09AM
The best solution to the debate is more research. Astronomy is one of the most exciting fields right now with several huge projects to do. The US needs to show leadership and ambition in technology again and a great place to start would be funding the OWL telesceope and other large ground observatories as well as expanding the orbital telescope program. The Drake equation wasn't vacuous but rather empty due to an almost complete lack of information, but now the unknown are begining to be filled.
It is time for ambition and leadership with more support of science and research.
Kingofthenet| 11.8.11 @ 11:18AM
For the MOST part religious People are hypocrites, i have no doubt that if a miracle treatment for whatever SERIOUS issue affects you was found but the ONLY way it could be done was by killing little unborn babies(Embryonic Stem Cells), you people would rationalize it in someway to help you sleep at night but get it done. Pretty much only the Jehovah Witnesses have the misplaced courage of their convictions, to refuse perfectly effective life-saving medical procedures. (this doesn't make them better, just more consistent)
DaveD| 11.8.11 @ 10:46PM
I wouldn't or better yet, I won't. And I have already told my Doctor no treatments based on embryonic stem cells EVER.
Tina B| 11.8.11 @ 11:37AM
I don't know that the generation with that kind of ambition and leadership to support astronomical science and space research is anywhere to be found, today, at least in this country.
My dad left Poland for England after the war, and used his engineering (military) degree to make it to the U. S. of A and ended up designing parts of the Apollo program in SoCal in the 60s. He, and many other Eastern Europeans, had the drive and ambition to overcome the language barrier (with the help of his British wifey) and rise to prominence, as well as help put man on the moon. How I loved him. Still do.
But after teaching math in Florida for the past 20 years, thanks to Papa's help in Calc I and II at UCF, I have my doubts that there are enough good math students to carry that ball. I taught a few, brave souls in their middle school community, making straight As and breezing through Alg 1 Honors and doing the challenging stuff outside the classroom. As the years passed, their numbers grew fewer and fewer.
I retired before I lost heart to play full press on the court. I saw better women than me cry, in pain, at the lack of respect, day after day. Respect for math and science, respect for authority, respect for each other, respect for themselves. All diminishing.
Our space exploration days may be over, along with many other billion dollar scientific endeavors.
MOS was 71331| 11.8.11 @ 11:39AM
Did Darwin suggest any physical mechanism to cause the mutations that might make a creature, plant or animal, more fit to survive? I believe that radiation is today's usual suspect, but I doubt radiation's properties (capabilities) were well understood (particularly by Darwin) when Darwin was alive.
Did Darwin conjecture any particular mechanisms causing mutations, or did he propose that the mutations were random events?
trekin| 11.8.11 @ 11:58AM
DNA, structure and role in genetics, were not discovered until well after Darwin died so it is unlikely that he proposed methods by which it could change. However, building one the work of Mendel and other biologists he knew that traits wereheritible and that genes could code for slightly different traits.
Kingofthenet| 11.8.11 @ 11:58AM
Did you ever notice there were FAR more biting Dogs years ago? I am not talking the relatively new Pit bull deal, but MEAN dogs of all stripes are pretty rare today, because all the Mean dogs were killed off years ago, no one wanted that. So the ONLY dogs that breed today are friendly dogs, that is selection not natural, but natural works the same way.
C Smith| 11.8.11 @ 11:46AM
The search for "terrestrial intelligence" has gone on for more than 100 years, and in a way it continues:
A skullcap and a femur uncovered a year and twelve meters apart, was the "quintessential evidence" for Java Man on the Indonesian island of that name. Eugène Dubois, the self-assured discoverer, immediately christened his find Pithecanthropus Erectus (erect ape man).
Imaginative artistic reconstructions, based on a single bone and a skull fragment, appeared in newspapers, magazines, and academic journals arresting the 1892 public’s attention.
The creditability of the discovery was immediately challenged, and the “brute” was generally dismissed as the jumbled combination of human and ape remains. Although Dubois contested that the relics were from a single individual, decades later it was reported that his Pithecanthropus collection contained an additional left femur i.e., Java Man had “two left feet.”
However, despite the hominid’s dubious authenticity, the “evidence” came just in time to rescue Darwin’s waning theory of evolution, a theory that had been increasingly discredited due to a lack of transitional fossil evidence.
The real intrigue of the Java narrative is not the revelation of some primeval “brute” but rather the humanity of its “evolved” counterpart who, compelled by arrogance and ambition, coerced his family to leave the familial setting of his professorship in Amsterdam and live among the danger, pestilence, and stagnant malaria infested waters of the impenetrable jungles of Java. Dubois buried four children there (American Scientist, Vol: 87, Num: 6, p504). And as the desperate ship’s captain, on the itinerant paleontologist’s eventual return to Europe, readied the lifeboats during a violent storm, Dubois instructed his wife: “If the lifeboat is lowered, you see to the little ones, for I shall have to look after this [Pithecanthropus]."
http://darwinsalbatross.blogsp.....-post.html
Because that which may be known of God is manifest in them; for God hath shewed it unto them. For the invisible things of him from the creation of the world are clearly seen, being understood by the things that are made, even his eternal power and Godhead; so that they are without excuse: Because that, when they knew God, they glorified him not as God, neither were thankful; but became vain in their imaginations, and their foolish heart was darkened. Professing themselves to be wise, they became fools, And changed the glory of the uncorruptible God into an image made like to corruptible man, and to birds, and fourfooted beasts, and creeping things. Wherefore God also gave them up to uncleanness through the lusts of their own hearts, to dishonour their own bodies between themselves: Who changed the truth of God into a lie, and worshipped and served the creature more than the Creator, who is blessed for ever. Amen. For this cause God gave them up unto vile affections: for even their women did change the natural use into that which is against nature: And likewise also the men, leaving the natural use of the woman, burned in their lust one toward another; men with men working that which is unseemly, and receiving in themselves that recompence of their error which was meet" Romans 1:19 -27).
Kingofthenet| 11.8.11 @ 12:14PM
We have ABSOLUTE proof of Pre Modern man, whether we are talking relatively 'close' like Neanderthals or pretty different and far more primitive like Lucy. Just take neanderthals We KNOW, they are NOT Modern man, yet they wore clothes, fought with weapons and buried their dead with honors. They clearly weren't a LOW form of life, yet the Bible is silent about them...
PaulyD| 11.8.11 @ 12:52PM
So what are pygmies?
Kingofthenet| 11.8.11 @ 12:56PM
Same as Preuvians, Modern People (Just a little shorter), not to many native Blonds with Blue Eye's in Africa either or with slanty eye's and yellowish skin.So what?
PaulyD| 11.8.11 @ 1:10PM
I think you can make the case that Neanderthals are physiologically as close to modern people as pymies are, and hence are just as much descendants of Adam as the rest of us.
JimH| 11.8.11 @ 1:06PM
There has been a strain of thought in various religions saying that man ought not to be concerned with worldly things; that he ought to be preparing for what comes after. I can’t accept this, at least not fully. I look on the universe as the grand work of Divine creation. If he made it, who are we to turn our back on it. I like to think that this vast wonderful creation has been made at least in part for us to explore, learn, grow and maybe just begin to appreciate the God who has placed it before us.
PaulyD| 11.8.11 @ 1:13PM
Yes, while it lasts.
Doctor Right| 11.8.11 @ 1:41PM
We have to be IN the world, but we don't have to be OF the world.
However, my personal opinion is that too many Christians interpret this as a complete disengagement from worldly affairs, like politics.
I consider that foolhardy and hopelessly naive.
Margie| 11.8.11 @ 8:03PM
Agreed. We need their votes.
VOTE, Christians, VOTE!
Anthony| 11.8.11 @ 1:54PM
Interesting, the more things change, the more they stay the same.
So Carl Sagan and Richard Dawkins were obsessed with a race(s) of superior beings existing in the universe.
To think, these highly educated men living in a technological wonder world were no different than the ancients who drew huge figures on the ground so the extra-terresterials would observe them from above.
We ain't come a long way baby!!!
trekin| 11.8.11 @ 6:54PM
There is no evidence that either Dawkins or Sagan were obsessed with aliens. Interested sure but hardly obsessed.
Fallgold| 11.8.11 @ 1:58PM
To better understand how special our planet is, I recommend the book "The Privileged Planet" by J Richards and G. Gonzelez. They detail many aspects of our world that make it a habitable location, including factors such as tectonic plate movement, our relationship to the Moon and the tilt of the Earth, various climate feedback systems, our favorable location within the Milky
Way Galaxy, etc.
I would conclude that, while life elsewhere could not be ruled out, the many special conditions that exist for this Earth plus the complexity of human beings themselves living on this Earth, certainly for me leads to a faith in a Creator that we call God.
I find encouragement in these verses from the Bible:
" In the beginning God created the heavens
and the earth.: (Gen 1:1)
" The heavens are the Lord's heavens, but the
earth he has given to the sons of men."
(Psalms 115:16 )
Tina B| 11.8.11 @ 2:48PM
Two thoughts:
This is my Father's world,
and to my listening ears
all nature sings and around me rings
the music of the spheres.
and
When we've been there ten thousand years,
bright shining as the sun,
we've no less days to sing God's praise
than when we first begun.
I love it when you all write about Him, your faith in Him, and delight in His creation, it's awesome. Thank you.
Ken (Old Texican)| 11.8.11 @ 3:56PM
Tina,
.......for even a wretch like me.
Too Many Tims| 11.8.11 @ 4:26PM
Why waste your time listening for voices from the stars when you refuse to hear God's voice emenating from within?
Pat| 11.8.11 @ 4:55PM
State religions can cause many problems but at least two government guys don’t show up on your doorstep during the game wanting to discuss passages from “Origin of Species by Means of Natural Selection”. Money is the sustaining root of all state religions – there are a lot of deserving mouths to feed among the clergy and us believers and non-believers alike are expected to feed them. Additionally, NASA and the National Science Foundation are two agencies tasked with dispensing alms to the poor in this country – the poor being scientists in white lab coats surrounded by deserving grad students. Both agencies have generously funded evolution research in the past using tax dollars, which makes sense from a state religion perspective although a little hard on us taxpayers also chipping in to support our chosen Old Religion.
But during a time when religions are changing, during times when a new religion is struggling to gain ascendency, we should perhaps be grateful that money is all that is presently demanded from us infidels. In other nations, a cartoon ridiculing religion can bring a warning note pinned to your chest via a knife through your heart. Here, in this country, it’s still merely a battle for our money - Science is not only a jealous god but apparently a greedy one as well.
But even a half billion dollars to Soylandra, donated in the name of Holy Gaia and the Great Green God, causes only financial burning at the stake, no blood is shed. Congress would love to know where all that Soylandra money actually went but you can’t put those Cayman Island bankers on the rack - and without some modern form of Inquisition they simply refuse to say.
Peter McGrath| 11.8.11 @ 4:56PM
Given the astronomical odds against life, in any form (let alone a form as infinitely complex as man), evolving through naturally recurring processes, it should be easy for anyone to conclude that life here, or on other worlds, would be so improbable as to be impossible without an intelligent 'designer' either tweaking the odds - or actually creating such life.
Here's the rub: given what we now know to be the infinitely mind boggling improbability of complex life occurring here on Earth, we may be forced to conclude that we are, truly, alone in this universe (but not all other universes, as may well exist according to string theory).
It's becoming increasingly difficult for naturalists to contest new statistical models which establish the absurdity of life springing into existence on its own.
From this perspective, it's far easier, even for a naturalist, to at least consider the possibility of a Holy God (or godhead) at the center of the equation.
Nick| 11.8.11 @ 5:42PM
Michael Crichton's excellent decimation of the imbecilic Drake's Equation can be found here:
http://online.wsj.com/article/.....07975.html
trekin| 11.8.11 @ 6:48PM
This isn't a decimation, it is Crichton saying he doesn't like guesses. No one ever claimed the equation was more than a crude first stab as a place to start and it has led to interesting questions. When first penned the only known variable was that there were trillions of stars. Current research indicates that many or even most of those have orbiting planets. Astronmers are now looking for planets that have the properties we know to be compatible with life. With future planned telescopes it may be possible to detect the signs of life (oxygen atmosphere). That's half way through the equation.
There are likely more variables that were not considered and some of the unknown may never be known. But you have to start somewhere.
Nick| 11.8.11 @ 7:25PM
trekin,
With all due respect, Carl Sagan built a whole career on that stupid equation.
As the late, great Mr. Crichton points out, the values for the variables cannot be known, or, even be guessed at intelligently. From the Wall Street Journal article: "The Drake equation can have any value from 'billions and billions' to zero. An expression that can mean anything means nothing." (Emphasis mine.)
This kind of speculation should be relegated to the writers of Star Trek, and not actual scientific inquiry.
Perusha| 11.8.11 @ 6:12PM
There is ONLY God.
God is all that is.
All that is IS God.
God is the One, before there is an other.
Radiant Transcendental Being, prior to ANY split into a subjective AND objective world.
God is Spirit, or Sat-Chit-Ananda =
Being-Consciousness-Bliss.
To notice anything is to feel short of Infinity.
Boundaries are ASSUMED. All ways and always.
Why, "your" own epidermis is constantly gaining and losing elements, and the body "you" take yourself to be is know by materialistic SCIENCE to have not a single atom over seven years old.
Most atoms slip and slide in and out much faster.
You are simply God, in an apparently unique temporary form---for a while.
Smile.
Yes---remember the "freak", Timothy Leary, who wrote a book, S.M.I(squared) L.E.
Space Migration, Increased Intelligence, Life Extension.
Feel the BEING!
Enjoy It all.
PaulyD| 11.8.11 @ 8:02PM
Wel,l I was wondering when the New Agers would show up!
skip| 11.11.11 @ 2:44AM
Whoa. Dude. We're nothing but star dust. So THAT'S what Genesis 3:19 means. Far out. In space, man.
"By the sweat of your brow you will eat your food until you return to the ground, since from it you were taken; for dust you are and to dust you will return."
Or am I confusing that with the Christmas season suddenly in full swing. Maybe that's the dust in Cheech Chong 2:1971.
"On Chewy! On Tavo! C'mon Beto!"
PeteKinnon | 11.8.11 @ 9:21PM
It may be that the evolutionary process that we call life may be far more robust and extensive than envisioned by Gould.
A process that extends well beyond the biological realm.
This is a key feature of the very broad evolutionary model that is very informally sketched out in "The Goldilocks Effect: What Has Serendipity Ever Done For Us?" (free download in e-book formats from my "Unusual Perspectives" website)
POST American| 11.9.11 @ 1:10AM
--Of course, the alien thing was sourced
and has been on the go since arch EUGENIST
and Milner/ Rhodes Globalist H G Wells in the 1890s.
It made its first high profile show NOT in
the US ---but in re-revolutionary Russia.
Check out Scriabin's 'Final Mystery'.
Just the thing for eclipsing the relevance of
those pesky Christians and their absurd,
PRE-EUGENICS notions of the sacredness
of human life.
----------HUAC meets NUREMBERG 2012----------
Richard Baker| 11.9.11 @ 6:45AM
Dr. Right:
Entropy, as I understand it, says that everything goes from a higher order to a lower order. As an example, a bar of iron decays to rust and rust cannot become an iron bar. So how does a single-celled paramecium become Man? This kind of "science" is more political science than anything else. That and intellectual arrogance.
diviz| 11.9.11 @ 9:52AM
If entropy can only increase why are there any iron bars?
PeteKinnon | 11.9.11 @ 2:39PM
Richard,
Entropy can (and sometimes does) decrease locally, but globally it is accompanied by a net increase.
The dysentropy so very apparent in biology is still characterized by a net increase in entropy.
An everyday metaphor might make it clearer to you: You can increase your effective wealth by borrowing $10,000 from you bank. But your overall wealth actually decreases 'cos of the heap of interest you're gonna have to pay.
My book "Unusual Perspectives" (free download) may help clear up any misconceptions over such things
Tina B| 11.9.11 @ 9:47AM
Stated very succinctly, Mr. Baker, thanks.
Tenn Slim| 11.10.11 @ 7:33AM
Recc all read the History of Eugenics.
Then read "Masters of Deceit" circa 1954.
Then read Dawkins Theories of the Universe.
NOTE. The thread is that the Human Condition is explained via Dialectical Materialism, a Psuedo Science espoused in the 1930s, promulgated in the 1950s, legislatively enacted in the 1960s, and we are living in the blatant glare of the Secular Society known as Obama Care, Stimulus for Civil Servicants, and a riotous OWS dedicated to preserving the gains made by a flim flam keno election of 2008.
IF SETI did find intelligentisia on some planet and they were somehow able to view this Evolution of ours, they would shut down communications. One Plauque on one planet is enough.
Semper Fi
Richard Baker| 11.10.11 @ 7:45AM
Appreciate the comments but the thrust of my statement is that everything in the natural world moves towards said decay. There are iron bars which due to that decaying will eventually turn to rust and not the other way. Again, for the evolution crowd, how does a lesser order become a higher order?
diviz| 11.10.11 @ 12:24PM
if, as you seem to believe, the rules of thermodynamics require that entropy can only increase than it would be possible for the iron bars of your example to exist becuase as you note the entropy of the bar is less than that of the oxide.
However, as has been repeatedly explained in the forums and as every engineer will explain energy can be used to do work and thereby locally decrease entrop. The earth is an open system that absorbs energy from the sun drive the process of genetic duplication and mutation.
These facts are frequently and feeblely opposed by creationists. But consider in this market based capitalist economy with a booming life sciences industry, approximately 100% of corporate research money (hundreds of billions) go to biologists/chemists/computer scientists who work with or base there work on evolutionary priciples No corporate research money goes to frauds such as Behe or Mayer. This is because Behe, Mayer and their ilk only produce useless books and speaking engagements.
Capitalism supports evolution.
diviz| 11.10.11 @ 12:25PM
typoe in line 2 should read "impossible for the iron bars of your example to exist"
PeteKinnon | 11.11.11 @ 2:54PM
A small modification to your astute post, diviz. You say:
"Capitalism supports evolution"
It would more accurate to say that capitalism is itself an evolutionary process!
Furthermore, it is a product of the much wider evolutionary process outlined in "The Goldilocks Effect: What Has Serendipity Ever Done For Us?"
skip| 11.10.11 @ 12:35PM
Maybe those who disagree with you can name one thing that exists in the natural world that does not deteriorate over time when it is left alone.
dat atheist| 11.11.11 @ 11:09PM
Wow, the point of this article seems just incredibly dogmatic and ignorant to me, just like all christian view points...
Obviously the author doesn't know anything about SETI and astronomies in general. Calling a scientific field a "religion" just because it denies and disprooves the regressive and malicious teachings of religions in general doesn't solve the topic itself.
Unlike religious faith like the so called "Holy Book" or "Quran", those scientists at SETI and NASA have actual eviedence they can back their assumptions and claims on. The fruits and discoverings of their work is something actually real, something you can compare things in the real world to.
It's not made-up mumbo jumbo like the religious belief in some allmighty "creator" who put us as a choosen species on this piece of rock in such an enourmously vast space.
But yeah. Denial, limitless ignorance and lies are two things Religion is very famous for throughout human history. Rest assured that SETI will find something during the next decades. Clock is ticking for you guys.
I'd be scared too if i were you, lol.
Rich D| 11.12.11 @ 3:00PM
d. a.: "Obviously the author doesn't know anything about SETI and astronomies in general. Calling a scientific field a "religion" just because it denies and disprooves the regressive and malicious teachings of religions in general doesn't solve the topic itself."
Nor does your claim alone convince. Just what teachings have been disproven?
"Unlike religious faith like the so called "Holy Book" or "Quran", those scientists at SETI and NASA have actual eviedence they can back their assumptions and claims on."
So tell us- what evidence?
diviz| 11.18.11 @ 4:11PM
Conservatives hate scientists and engineers.
They keep trying to deny it but then junk like this gets published prooving once again how much all those NERDS.
What's next: an attack on Starwars/Startrek, how roleplaying and video games are the works of satan, or how comic books are for losers.
Engineers should be a natural republican block but I don't know any thatcan stomach the GOP and it is mainly because of its embrace of Bethel's kind of anti-science bile.
skip| 11.19.11 @ 4:02PM
On 11.10, above, I stated "Maybe those who disagree with (Richard Baker) can name one thing that exists in the natural world that does not deteriorate over time when it is left alone".
Perhaps, eight days later, instead of one more idiotic post, consisting of nothing more than idiotic emotional prattle devoid of any reason and experience based on intelligence and honesty, you could provide one thing to refute the statement.
Conservatives love science, which serves to epistemologically explain the creation of God both cosmologically and ontologically.
Conservatives hate that some individuals claim as scientists and engineers those who emotionally prattle in the name of reason and experience, when in reality they emotionally prattle both unintelligently and dishonestly.
Conservatives also hate that some individuals are so pathetically and despicably unintelligent and dishonest that they can't even comprehend this basic reality, despite providing them with abundant reason and experience to the contrary in many, many threads, over and over, even as these pathetic and despicable individuals continue to emotionally prattle endlessly on about utter nonsense as, for instance, the thoroughly discredited 'theory' of 'evolution'.
Mark| 11.21.11 @ 1:58PM
This article proproses an argument that even Darwin would find "crazy". The argument both for and against Evolution is a straw man. We cannot present the so-called missing link between humans and apes. But we can map the DNA. We don't see tails failing off monkey's butts. But we can observe salamaders with no eyes, because thier habitat requires none.
I don't understand why the Sumerian tablets are not taken for the truth. After all. They present a more believable story of actual events than second, third or fourth handed myths and legends by temple priest in Egypt.
Here's the story of "evolution" as it really happened.
Hundreds of thousands of years ago. Earth was visited by a superior race of beings. These beings experimented with all sorts of animals and eventually created hybrids. From those hybrids.
A stronger species was bred with the superior race. From this "marriage". Came man.
If you research all of the remaining histories of mankind. Every civilisation admits as much.
Why is it so hard to put down a doctrine like the bible, torah and koran? Because we are ALLOWED to believe such nonsense to keep the sheep in their pens and submit whenever required.
Ken (Old Texican)| 11.22.11 @ 4:50PM
OK Mark, so who created those "superior beings" dumbass?
best small dog breeds | 12.1.11 @ 1:46PM
information is good, please kindly read this website I provided here. I think it will be very useful to the Topic Starter.